Human CACNA1C activation kit by CRISPRa

SKU GA100540

CACNA1C CRISPRa kit - CRISPR gene activation of human calcium voltage-gated channel subunit alpha1 C

Product Data

• Format: 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
• Target Symbol: CACNA1C
• Locus ID: 775
• Components:

  GA100540G1, CACNA1C gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTTTGATAGACCCTCTTGTG

  GA100540G2, CACNA1C gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAGATCACCATGCCTTAGGG

  GA100540G3, CACNA1C gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCGTAAAGCCACTGGCTGAG

  1 CRISPRa-Enhancer vector, SKU GE100056

  1 CRISPRa scramble vector, SKU GE100077

• OTI Disclaimer: These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
• Shipping: Ambient

Reference Data

• RefSeq: NM_000719, NM_001129827, NM_001129829, NM_001129830, NM_001129831, NM_001129832, NM_001129833, NM_001129834, NM_001129835, NM_001129836, NM_001129837, NM_001129838, NM_001129839, NM_001129840, NM_001129841, NM_001129842, NM_001129843, NM_001129844, NM_001129846, NM_001167623, NM_001167624, NM_001167625, NM_199460
• UniProt ID: Q13936
• Synonyms: CACH2; CACN2; CACNL1A1; CaV1.2; CCHL1A1; LQT8; TS
• Summary: This gene encodes an alpha-1 subunit of a voltage-dependent calcium channel. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization. The alpha-1 subunit consists of 24 transmembrane segments and forms the pore through which ions pass into the cell. The calcium channel consists of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. There are multiple isoforms of each of these proteins, either encoded by different genes or the result of alternative splicing of transcripts. The protein encoded by this gene binds to and is inhibited by dihydropyridine. Alternative splicing results in many transcript variants encoding different proteins. Some of the predicted proteins may not produce functional ion channel subunits. [provided by RefSeq, Oct 2012]