Human RED1 (ADARB1) activation kit by CRISPRa

SKU GA100068

ADARB1 CRISPRa kit - CRISPR gene activation of human adenosine deaminase RNA specific B1

Product Data

• Format: 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
• Target Symbol: ADARB1
• Locus ID: 104
• Components:

  GA100068G1, RED1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCGTGTCTGTCGTGGGCAGC

  GA100068G2, RED1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGAGTCTCCTCAGCCGCGCT

  GA100068G3, RED1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TGAGGGAGGTGCCACAGCTC

  1 CRISPRa-Enhancer vector, SKU GE100056

  1 CRISPRa scramble vector, SKU GE100077

• OTI Disclaimer: These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
• Shipping: Ambient

Reference Data

• RefSeq: NM_001033049, NM_001112, NM_001145407, NM_001160230, NM_015833, NM_015834, NR_027672, NR_027673, NR_027674, NR_073200, NM_001346687, NM_001346688, NR_144483
• UniProt ID: P78563
• Synonyms: ADAR2; ADAR2a; ADAR2a-L1; ADAR2a-L2; ADAR2a-L3; ADAR2b; ADAR2c; ADAR2d; ADAR2g; DRABA2; DRADA2
• Summary: This gene encodes the enzyme responsible for pre-mRNA editing of the glutamate receptor subunit B by site-specific deamination of adenosines. Studies in rat found that this enzyme acted on its own pre-mRNA molecules to convert an AA dinucleotide to an AI dinucleotide which resulted in a new splice site. Alternative splicing of this gene results in several transcript variants, some of which have been characterized by the presence or absence of an ALU cassette insert and a short or long C-terminal region. [provided by RefSeq, Jul 2008]