OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Human RED1 (ADARB1) activation kit by CRISPRa

Be the first to review this product
SKU
GA100068
ADARB1 CRISPRa kit - CRISPR gene activation of human adenosine deaminase RNA specific B1
  $1,657.00
4 Weeks*

Frequently Bought Together (2)

TA345762 Rabbit Polyclonal Anti-ADARB1 Antibody
100 ul
$525.00
RC209073 ADARB1 (Myc-DDK-tagged)-Human adenosine deaminase, RNA-specific, B1 (ADARB1), transcript variant 1
10 ug
$963.00

Other products for "ADARB1"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol ADARB1
Locus ID 104
Components

GA100068G1, RED1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCGTGTCTGTCGTGGGCAGC

GA100068G2, RED1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGAGTCTCCTCAGCCGCGCT

GA100068G3, RED1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TGAGGGAGGTGCCACAGCTC

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_001033049, NM_001112, NM_001145407, NM_001160230, NM_015833, NM_015834, NR_027672, NR_027673, NR_027674, NR_073200, NM_001346687, NM_001346688, NR_144483
UniProt ID P78563
Synonyms ADAR2; ADAR2a; ADAR2a-L1; ADAR2a-L2; ADAR2a-L3; ADAR2b; ADAR2c; ADAR2d; ADAR2g; DRABA2; DRADA2
Summary This gene encodes the enzyme responsible for pre-mRNA editing of the glutamate receptor subunit B by site-specific deamination of adenosines. Studies in rat found that this enzyme acted on its own pre-mRNA molecules to convert an AA dinucleotide to an AI dinucleotide which resulted in a new splice site. Alternative splicing of this gene results in several transcript variants, some of which have been characterized by the presence or absence of an ALU cassette insert and a short or long C-terminal region. provided by RefSeq, Jul 2008
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN409073 ADARB1 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products