COQ2 (NM_015697) Human Untagged Clone

SKU
SC327846
COQ2 (untagged)-Human coenzyme Q2 homolog prenyltransferase (yeast) (COQ2) nuclear gene encoding mitochondrial protein
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol COQ2
Synonyms CL640; COQ10D1; MSA1; PHB:PPT
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC327846 representing NM_015697.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGACCCCAATTTCACAAGTAAGGATGAGGAAAGGTTCTGCCCACACCGCCGCCCAGCCTGGCAGACTA
GGATTGCATCCTGCGGGTGCCACTGCGCATGCCTGCCGGGGAATGACGTCAATCCGAGCTCGTCCCGGC
CTCACCAGCGCCATGCTGGGCTCGCGAGCCGCGGGGTTCGCGCGGGGCCTGCGGGCTGTGGCACTGGCG
TGGCTGCCGGGCTGGCGGGGCCGCTCCTTCGCCCTGGCGCGTGCGGCAGGCGCGCCCCACGGTGGTGAC
TTGCAGCCCCCCGCCTGTCCCGAGCCGCGCGGGCGCCAGCTCAGTTTGTCCGCGGCGGCGGTGGTGGAC
TCTGCGCCCCGCCCCCTGCAGCCGTACTTGCGCCTCATGCGGTTGGACAAGCCCATTGGAACCTGGCTT
CTGTATTTACCATGTACCTGGAGCATTGGTTTGGCAGCTGAACCAGGTTGTTTTCCAGATTGGTACATG
CTCTCCCTCTTTGGCACTGGAGCTATTCTGATGCGTGGAGCAGGCTGTACTATTAATGACATGTGGGAC
CAGGACTATGATAAAAAGGTTACAAGAACAGCCAATCGTCCAATAGCCGCTGGAGACATTTCAACTTTT
CAGTCCTTTGTTTTTCTTGGGGGACAGCTAACCCTGGCACTGGGTGTTCTTCTGTGTCTAAATTACTAC
AGTATAGCTCTGGGAGCAGGATCCTTACTTCTTGTCATCACCTACCCACTAATGAAAAGAATTTCATAC
TGGCCTCAACTAGCCTTGGGCTTGACATTTAATTGGGGAGCGTTACTTGGATGGTCTGCTATCAAGGGT
TCCTGTGATCCATCTGTTTGCCTGCCTCTTTATTTTTCTGGAGTTATGTGGACACTAATATATGATACT
ATTTATGCCCATCAGGACAAAAGAGATGATGTTTTGATTGGTCTTAAGTCAACGGCTCTGCGGTTCGGA
GAAAATACCAAGCCGTGGCTCAGCGGCTTCAGTGTTGCAATGCTGGGGGCACTGAGCCTAGTGGGTGTG
AACAGTGGACAGACTGCTCCCTACTACGCTGCCCTGGGTGCTGTAGGAGCCCATCTGACTCACCAGATT
TACACTCTAGACATCCACAGACCTGAGGATTGTTGGAATAAATTTATCTCCAACCGAACACTGGGACTA
ATAGTTTTTTTAGGGATTGTCCTTGGGAATTTGTGGAAAGAAAAGAAGACAGACAAAACAAAGAAGGGT
ATAGAGAATAAAATAGAAAATTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_015697
Insert Size 1266 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_015697.7
RefSeq Size 1657 bp
RefSeq ORF 1266 bp
Locus ID 27235
Cytogenetics 4q21.22-q21.23
Protein Families Transmembrane
Protein Pathways Ubiquinone and other terpenoid-quinone biosynthesis
MW 45.6 kDa
Summary This gene encodes an enzyme that functions in the final steps in the biosynthesis of CoQ (ubiquinone), a redox carrier in the mitochondrial respiratory chain and a lipid-soluble antioxidant. This enzyme, which is part of the coenzyme Q10 pathway, catalyzes the prenylation of parahydroxybenzoate with an all-trans polyprenyl group. Mutations in this gene cause coenzyme Q10 deficiency, a mitochondrial encephalomyopathy, and also COQ2 nephropathy, an inherited form of mitochondriopathy with primary renal involvement. [provided by RefSeq, Oct 2009]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:COQ2 (NM_015697) Human Untagged Clone
Your Rating
SKU Description Size Price
RC229211 COQ2 (Myc-DDK-tagged)-Human coenzyme Q2 homolog, prenyltransferase (yeast) (COQ2), nuclear gene encoding mitochondrial protein 10 ug
$289.00 MSRP $457.00 MSRP $457.00
RC229211L1 Lenti ORF clone of Human coenzyme Q2 homolog, prenyltransferase (yeast) (COQ2), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged 10 ug
$757.00
RC229211L2 Lenti ORF clone of Human coenzyme Q2 homolog, prenyltransferase (yeast) (COQ2), nuclear gene encoding mitochondrial protein, mGFP tagged 10 ug
$757.00
RC229211L3 Lenti ORF clone of Human coenzyme Q2 homolog, prenyltransferase (yeast) (COQ2), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged 10 ug
$757.00
RC229211L4 Lenti ORF clone of Human coenzyme Q2 homolog, prenyltransferase (yeast) (COQ2), nuclear gene encoding mitochondrial protein, mGFP tagged 10 ug
$757.00
RG229211 COQ2 (tGFP-tagged) - Human coenzyme Q2 homolog, prenyltransferase (yeast) (COQ2), nuclear gene encoding mitochondrial protein 10 ug
$657.00
SC112582 COQ2 (untagged)-Human coenzyme Q2 homolog, prenyltransferase (yeast) (COQ2), nuclear gene encoding mitochondrial protein 10 ug
$457.00
SC320968 COQ2 (untagged)-Human coenzyme Q2 homolog, prenyltransferase (yeast) (COQ2), nuclear gene encoding mitochondrial protein 10 ug
$457.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.