DDIT3 (NM_004083) Human Untagged Clone

CAT#: SC324377

DDIT3 (untagged)-Human DNA-damage-inducible transcript 3 (DDIT3), transcript variant 5


  "NM_004083" in other vectors (7)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
DDIT3 mouse monoclonal antibody,clone OTI3H7
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "DDIT3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol DDIT3
Synonyms AltDDIT3; C/EBPzeta; CEBPZ; CHOP; CHOP-10; CHOP10; GADD153
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_004083.4 GAGAGAGAGAGACTTAAGTCTAAGGCACTGAGCGTATCATGTTAAAGATGAGCGGGTGGC
AGCGACAGAGCCAAAATCAGAGCTGGAACCTGAGGAGAGAGTGTTCAAGAAGGAAGTGTA
TCTTCATACATCACCACACCTGAAAGCAGATGTGCTTTTCCAGACTGATCCAACTGCAGA
GATGGCAGCTGAGTCATTGCCTTTCTCCTTTGGGACACTGTCCAGCTGGGAGCTGGAAGC
CTGGTATGAGGACCTGCAAGAGGTCCTGTCTTCAGATGAAAATGGGGGTACCTATGTTTC
ACCTCCTGGAAATGAAGAGGAAGAATCAAAAATCTTCACCACTCTTGACCCTGCTTCTCT
GGCTTGGCTGACTGAGGAGGAGCCAGAACCAGCAGAGGTCACAAGCACCTCCCAGAGCCC
TCACTCTCCAGATTCCAGTCAGAGCTCCCTGGCTCAGGAGGAAGAGGAGGAAGACCAAGG
GAGAACCAGGAAACGGAAACAGAGTGGTCATTCCCCAGCCCGGGCTGGAAAGCAGCGCAT
GAAGGAGAAAGAACAGGAGAATGAAAGGAAAGTGGCACAGCTAGCTGAAGAGAATGAACG
GCTCAAGCAGGAAATCGAGCGCCTGACCAGGGAAGTAGAGGCGACTCGCCGAGCTCTGAT
TGACCGAATGGTGAATCTGCACCAAGCATGAACAATTGGGAGCATCAGTCCCCCACTTGG
GCCACACTACCCACCTTTCCCAGAAGTGGCTACTGACTACCCTCTCACTAGTGCCAATGA
TGTGACCCTCAATCCCACATACGCAGGGGGAAGGCTTGGAGTAGACAAAAGGAAAGGTCT
CAGCTTGTATATAGAGATTGTACATTTATTTATTACTGTCCCTATCTATTAAAGTGACTT
TCTATGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_004083
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_004083.4, NP_004074.2
RefSeq Size 927 bp
RefSeq ORF 510 bp
Locus ID 1649
UniProt ID P35638
Cytogenetics 12q13.3
Domains BRLZ
Protein Families Druggable Genome, Transcription Factors
Protein Pathways MAPK signaling pathway
Gene Summary This gene encodes a member of the CCAAT/enhancer-binding protein (C/EBP) family of transcription factors. The protein functions as a dominant-negative inhibitor by forming heterodimers with other C/EBP members, such as C/EBP and LAP (liver activator protein), and preventing their DNA binding activity. The protein is implicated in adipogenesis and erythropoiesis, is activated by endoplasmic reticulum stress, and promotes apoptosis. Fusion of this gene and FUS on chromosome 16 or EWSR1 on chromosome 22 induced by translocation generates chimeric proteins in myxoid liposarcomas or Ewing sarcoma. Multiple alternatively spliced transcript variants encoding two isoforms with different length have been identified. [provided by RefSeq, Aug 2010]
Transcript Variant: This variant (5) lacks an internal segment in the 5' region, resulting in a downstream AUG start codon, as compared to variant 1. The resulting isoform (2) is shorter at the N-terminus, as compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.