DDIT3 (NM_004083) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | DDIT3 |
Synonyms | AltDDIT3; C/EBPzeta; CEBPZ; CHOP; CHOP-10; CHOP10; GADD153 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
Fully Sequenced ORF
>NCBI ORF sequence for NM_004083, the custom clone sequence may differ by one or more nucleotides
ATGGCAGCTGAGTCATTGCCTTTCTCCTTCGGGACACTGTCCAGCTGGGAGCTGGAAGCCTGGTATGAGG ACCTGCAAGAGGTCCTGTCTTCAGATGAAAATGGGGGTACCTATGTTTCACCTCCTGGAAATGAAGAGGA AGAATCAAAAATCTTCACCACTCTTGACCCTGCTTCTCTGGCTTGGCTGACTGAGGAGGAGCCAGAACCA GCAGAGGTCACAAGCACCTCCCAGAGCCCTCACTCTCCAGATTCCAGTCAGAGCTCCCTGGCTCAGGAGG AAGAGGAGGAAGACCAAGGGAGAACCAGGAAACGGAAACAGAGTGGTCATTCCCCAGCCCGGGCTGGAAA GCAGCGCATGAAGGAGAAAGAACAGGAGAATGAAAGGAAAGTGGCACAGCTAGCTGAAGAGAATGAACGG CTCAAGCAGGAAATCGAGCGCCTGACCAGGGAAGTAGAGGCGACTCGCCGAGCTCTGATTGACCGAATGG TGAATCTGCACCAAGCATGA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_004083 unedited
TATACGACTCACTATAGGCGGCCGCGAATTCGCACGAGGGTCCCAGCTACTCGGGAGGCC GAGGCAGAAGAACACTTGAACCGAGGAGGCAGAGGTTGCAGTGAGCCGAGATCGCACCAC TGCACTTCAGCCTGGCAACAGAGCAAGACTTGGTCTCAAAAAAAAAAAAAGAAAGAAAAA AAGAAAAAGAAAAGTAAGTTGCCTCTCCCCCTTCCAAAAATGGCTGACATTTCTCTTTGT TGCCCACAGTGTTCAAGAAGGAAGTGTATCTTCATACATCACCACACCTGAAAGCAGATG TGCTTTTCCAGACTGATCCAACTGCAGAGATGGCAGCTGAGTCATTGCCTTTCTCCTTCG GGACACTGTCCAGCTGGGAGCTGGAAGCCTGGTATGAGGACCTGCAAGAGGTCCTGTCTT CAGATGAAAATGGGGGTACCTATGTTTCACCTCCTGGAAATGAAGAGGAAGAATCAAAAA TCTTCACCACTCTTGACCCTGCTTCTCTGGCTTGGCTGACTGAGGAGGAGCCAGAACCAG CAGAGGTCACAAGCACCTCCCAGAGCCCTCACTCTCCAGATTCCAGTCAGAGCTCCCTGG CTCAGGAGGAAGAGGAGGAAGACCAAGGGAGAACCAGGAAACGGAAACAGAGTGGTCATT CCCCAGCCCGGGCTGGAAAGCAGCGCATGAAGGAGAAAGAACAGGAGATGAAAGGAAAGT GGCACAGCTAGCTGAAAAGATGAACGGCTCAAGCAGGAAATCGAGCGCCTGACCANNGAA GTAGAGGCGACTCGCCGAGCTCTGATTGACCGAATGGTGAATCTGCACCAGCATGAACAA TNGGGAGCATCAGTCCCCACTTGGGCCACACTACCACTTNNNCCAGAGTGCTACTGACTA CCTNTNACTAGTGCCATGATGTGACCCTCATCCACAACGCAGGGGAAGNNCTGGATN |
Restriction Sites | NotI-NotI |
ACCN | NM_004083 |
Insert Size | 1150 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_004083.4, NP_004074.2 |
RefSeq Size | 927 bp |
RefSeq ORF | 510 bp |
Locus ID | 1649 |
UniProt ID | P35638 |
Cytogenetics | 12q13.3 |
Domains | BRLZ |
Protein Families | Druggable Genome, Transcription Factors |
Protein Pathways | MAPK signaling pathway |
Summary | This gene encodes a member of the CCAAT/enhancer-binding protein (C/EBP) family of transcription factors. The protein functions as a dominant-negative inhibitor by forming heterodimers with other C/EBP members, such as C/EBP and LAP (liver activator protein), and preventing their DNA binding activity. The protein is implicated in adipogenesis and erythropoiesis, is activated by endoplasmic reticulum stress, and promotes apoptosis. Fusion of this gene and FUS on chromosome 16 or EWSR1 on chromosome 22 induced by translocation generates chimeric proteins in myxoid liposarcomas or Ewing sarcoma. Multiple alternatively spliced transcript variants encoding two isoforms with different length have been identified. [provided by RefSeq, Aug 2010] Transcript Variant: This variant (5) lacks an internal segment in the 5' region, resulting in a downstream AUG start codon, as compared to variant 1. The resulting isoform (2) is shorter at the N-terminus, as compared to isoform 1. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC201301 | DDIT3 (Myc-DDK-tagged)-Human DNA-damage-inducible transcript 3 (DDIT3), transcript variant 5 | 10 ug |
$300.00
|
|
RC201301L1 | Lenti ORF clone of Human DNA-damage-inducible transcript 3 (DDIT3), transcript variant 5, Myc-DDK-tagged | 10 ug |
$600.00
|
|
RC201301L2 | Lenti ORF clone of Human DNA-damage-inducible transcript 3 (DDIT3), transcript variant 5, mGFP tagged | 10 ug |
$600.00
|
|
RC201301L3 | Lenti ORF clone of Human DNA-damage-inducible transcript 3 (DDIT3), transcript variant 5, Myc-DDK-tagged | 10 ug |
$600.00
|
|
RC201301L4 | Lenti ORF clone of Human DNA-damage-inducible transcript 3 (DDIT3), transcript variant 5, mGFP tagged | 10 ug |
$600.00
|
|
RG201301 | DDIT3 (tGFP-tagged) - Human DNA-damage-inducible transcript 3 (DDIT3), transcript variant 5 | 10 ug |
$489.00
MSRP
$500.00
MSRP
$500.00
|
|
SC324377 | DDIT3 (untagged)-Human DNA-damage-inducible transcript 3 (DDIT3), transcript variant 5 | 10 ug |
$300.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.