DDIT3 (NM_004083) Human Untagged Clone

SKU SC324377

DDIT3 (untagged)-Human DNA-damage-inducible transcript 3 (DDIT3), transcript variant 5

Product Data

• Type: Human Untagged Clone
• Target Symbol: DDIT3
• Synonyms: AltDDIT3; C/EBPzeta; CEBPZ; CHOP; CHOP-10; CHOP10; GADD153
• Vector: pCMV6-AC
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_004083.4 GAGAGAGAGAGACTTAAGTCTAAGGCACTGAGCGTATCATGTTAAAGATGAGCGGGTGGC; AGCGACAGAGCCAAAATCAGAGCTGGAACCTGAGGAGAGAGTGTTCAAGAAGGAAGTGTA; TCTTCATACATCACCACACCTGAAAGCAGATGTGCTTTTCCAGACTGATCCAACTGCAGA; GATGGCAGCTGAGTCATTGCCTTTCTCCTTTGGGACACTGTCCAGCTGGGAGCTGGAAGC; CTGGTATGAGGACCTGCAAGAGGTCCTGTCTTCAGATGAAAATGGGGGTACCTATGTTTC; ACCTCCTGGAAATGAAGAGGAAGAATCAAAAATCTTCACCACTCTTGACCCTGCTTCTCT; GGCTTGGCTGACTGAGGAGGAGCCAGAACCAGCAGAGGTCACAAGCACCTCCCAGAGCCC; TCACTCTCCAGATTCCAGTCAGAGCTCCCTGGCTCAGGAGGAAGAGGAGGAAGACCAAGG; GAGAACCAGGAAACGGAAACAGAGTGGTCATTCCCCAGCCCGGGCTGGAAAGCAGCGCAT; GAAGGAGAAAGAACAGGAGAATGAAAGGAAAGTGGCACAGCTAGCTGAAGAGAATGAACG; GCTCAAGCAGGAAATCGAGCGCCTGACCAGGGAAGTAGAGGCGACTCGCCGAGCTCTGAT; TGACCGAATGGTGAATCTGCACCAAGCATGAACAATTGGGAGCATCAGTCCCCCACTTGG; GCCACACTACCCACCTTTCCCAGAAGTGGCTACTGACTACCCTCTCACTAGTGCCAATGA; TGTGACCCTCAATCCCACATACGCAGGGGGAAGGCTTGGAGTAGACAAAAGGAAAGGTCT; CAGCTTGTATATAGAGATTGTACATTTATTTATTACTGTCCCTATCTATTAAAGTGACTT; TCTATGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
• Restriction Sites: Please inquire
• ACCN: NM_004083
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_004083.4, NP_004074.2
• RefSeq Size: 927 bp
• RefSeq ORF: 510 bp
• Locus ID: 1649
• UniProt ID: P35638
• Cytogenetics: 12q13.3
• Domains: BRLZ
• Protein Families: Druggable Genome, Transcription Factors
• Protein Pathways: MAPK signaling pathway
• Summary: This gene encodes a member of the CCAAT/enhancer-binding protein (C/EBP) family of transcription factors. The protein functions as a dominant-negative inhibitor by forming heterodimers with other C/EBP members, such as C/EBP and LAP (liver activator protein), and preventing their DNA binding activity. The protein is implicated in adipogenesis and erythropoiesis, is activated by endoplasmic reticulum stress, and promotes apoptosis. Fusion of this gene and FUS on chromosome 16 or EWSR1 on chromosome 22 induced by translocation generates chimeric proteins in myxoid liposarcomas or Ewing sarcoma. Multiple alternatively spliced transcript variants encoding two isoforms with different length have been identified. [provided by RefSeq, Aug 2010]; Transcript Variant: This variant (5) lacks an internal segment in the 5' region, resulting in a downstream AUG start codon, as compared to variant 1. The resulting isoform (2) is shorter at the N-terminus, as compared to isoform 1.