C9ORF46 (PLGRKT) (NM_018465) Human Untagged Clone

SKU
SC322249
PLGRKT (untagged)-Human chromosome 9 open reading frame 46 (C9orf46)
$150.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol C9ORF46
Synonyms AD025; C9orf46; MDS030; Plg-R(KT); PLG-RKT
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for SC322249 GGAGCCCGGGCCTGGAGGTTTGCGTACCGGTCGCCTGGTCCCGGCACCAGCGCCGCCCAG
TGTGGTTTCCCATAAGGAAGCTCTTCTTCCTGCTTGGCTTCCACCTTTAACCCTTCCACC
TGGGAGCGTCCTCTAACACATTCAGACTACAAGTCCAGACCCAGGAGAGCAAGGCCCAGA
AAGAGGTCAAAATGGGGTTTATATTTTCAAAATCTATGAATGAAAGCATGAAAAATCAAA
AGGAGTTCATGCTTATGAATGCTCGACTTCAGCTGGAAAGGCAGCTCATCATGCAGAGTG
AAATGAGGGAAAGACAAATGGCCATGCAGATTGCGTGGTCTCGGGAATTCCTCAAATATT
TTGGAACTTTTTTTGGCCTTGCAGCCATCTCTTTAACAGCTGGAGCGATTAAAAAAAAGA
AGCCAGCCTTCCTGGTCCCGATTGTTCCATTAAGCTTTATCCTCACCTACCAGTATGACT
TGGGCTATGGAACCCTTTTAGAAAGAATGAAAGGTGAAGCTGAGGACATACTGGAAACAG
AAAAGAGTAAATTGCAGCTGCCAAGAGGAATGATCACTTTTGAAAGCATTGAAAAAGCCA
GAAAGGAACAGAGTAGATTCTTCATAGACAAATGAAATCATGCTTACCAATCAAATCTCA
AAGCACAGAATTATTGACTTGAATCATGGTTTTTACAGTTTTTTAAATGCTCAAGATTTT
GATATTATAGATTTTATTTTAAAATATTAAAATGCAAGATAGTTTTGAGCTATTTTAAAA
TAAAATTTATAACATTCAACACAAAATCATGGAGGTGCTCTAAATAACTTTTAGATTTCC
TCTCTCTGTGTGCATTACCAATATCTAAGTGTAAAATTAATAAATTGTTTTGAATTCCTG
GAAAAAAAAAAAAAAAA
Restriction Sites Please inquire
ACCN NM_018465
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_018465.1, NP_060935.1
RefSeq Size 927 bp
RefSeq ORF 444 bp
Locus ID 55848
UniProt ID Q9HBL7
Cytogenetics 9p24.1
Protein Families Transmembrane
Summary Receptor for plasminogen. Regulates urokinase plasminogen activator-dependent and stimulates tissue-type plasminogen activator-dependent cell surface plasminogen activation. Proposed to be part of a local catecholaminergic cell plasminogen activation system that regulates neuroendocrine prohormone processing. Involved in regulation of inflammatory response; regulates monocyte chemotactic migration and matrix metalloproteinase activation, such as of MMP2 and MMP9.[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:C9ORF46 (PLGRKT) (NM_018465) Human Untagged Clone
Your Rating
SKU Description Size Price
RC202315 PLGRKT (Myc-DDK-tagged)-Human chromosome 9 open reading frame 46 (C9orf46) 10 ug
$150.00
RC202315L1 Lenti ORF clone of Human chromosome 9 open reading frame 46 (C9orf46), Myc-DDK-tagged 10 ug
$450.00
RC202315L2 Lenti ORF clone of Human chromosome 9 open reading frame 46 (C9orf46), mGFP tagged 10 ug
$450.00
RC202315L3 Lenti ORF clone of Human chromosome 9 open reading frame 46 (C9orf46), Myc-DDK-tagged 10 ug
$450.00
RC202315L4 Lenti ORF clone of Human chromosome 9 open reading frame 46 (C9orf46), mGFP tagged 10 ug
$450.00
RG202315 PLGRKT (tGFP-tagged) - Human chromosome 9 open reading frame 46 (C9orf46) 10 ug
$350.00
SC113479 PLGRKT (untagged)-Human chromosome 9 open reading frame 46 (C9orf46) 10 ug
$150.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.