Twist(TWIST1) (NM_000474) Human Untagged Clone

CAT#: SC321467

TWIST1 (untagged)-Human twist homolog 1 (Drosophila) (TWIST1)

USD 402


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Twist(TWIST1) (NM_000474) Human Untagged Clone
Symbol TWIST1
Synonyms ACS3; bHLHa38; BPES2; BPES3; CRS; CRS1; CSO; SCS; TWIST
Vector pCMV6-AC
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_000474.3 GAGGTATAAGAGCCTCCAAGTCTGCAGCTCTCGCCCAACTCCCAGACACCTCGCGGGCTC
TGCAGCACCGGCACCGTTTCCAGGAGGCCTGGCGGGGTGTGCGTCCAGCCGTTGGGCGCT
TTCTTTTTGGACCTCGGGGCCATCCACACCGTCCCCTCCCCCTCCCGCCTCCCTCCCCGC
CTCCCCCGCGCGCCCTCCCCGCGGAGGTCCCTCCCGTCCGTCCTCCTGCTCTCTCCTCCG
CGGGCCGCATCGCCCGGGCCGGCGCCGCGCGCGGGGGAAGCTGGCGGGCTGAGGCGCCCC
GCTCTTCTCCTCTGCCCCGGGCCCGCGAGGCCACGCGTCGCCGCTCGAGAGATGATGCAG
GACGTGTCCAGCTCGCCAGTCTCGCCGGCCGACGACAGCCTGAGCAACAGCGAGGAAGAG
CCAGACCGGCAGCAGCCGCCGAGCGGCAAGCGCGGGGGACGCAAGCGGCGCAGCAGCAGG
CGCAGCGCGGGCGGCGGCGCGGGGCCCGGCGGAGCCGCGGGTGGGGGCGTCGGAGGCGGC
GACGAGCCGGGCAGCCCGGCCCAGGGCAAGCGCGGCAAGAAGTCTGCGGGCTGTGGCGGC
GGCGGCGGCGCGGGCGGCGGCGGCGGCAGCAGCAGCGGCGGCGGGAGTCCGCAGTCTTAC
GAGGAGCTGCAGACGCAGCGGGTCATGGCCAACGTGCGGGAGCGCCAGCGCACCCAGTCG
CTGAACGAGGCGTTCGCCGCGCTGCGGAAGATCATCCCCACGCTGCCCTCGGACAAGCTG
AGCAAGATTCAGACCCTCAAGCTGGCGGCCAGGTACATCGACTTCCTCTACCAGGTCCTC
CAGAGCGACGAGCTGGACTCCAAGATGGCAAGCTGCAGCTATGTGGCTCACGAGCGGCTC
AGCTACGCCTTCTCGGTCTGGAGGATGGAGGGGGCCTGGTCCATGTCCGCGTCCCACTAG
CAGGCGGAGCCCCCCACCCCCTCAGCAGGGCCGGAGACCTAGATGTCATTGTTTCCAGAG
AAGGAGAAAATGGACAGTCTAGAGACTCTGGAGCTGGATAACTAAAAATAAAAATATATG
CCAAAGATTTTCTTGGAAATTAGAAGAGCAAAATCCAAATTCAAAGAAACAGGGCGTGGG
GCGCACTTTTAAAAGAGAAAGCGAGACAGGCCCGTGGACAGTGATTCCCAGACGGGCAGC
GGCACCATCCTCACACCTCTGCATTCTGATAGAAGTCTGAACAGTTGTTTGTGTTTTTTT
TTTTTTTTTTTGACGAAGAATGTTTTTATTTTTATTTTTTTCATGCATGCATTCTCAAGA
GGTCGTGCCAATCAGCCACTGAAAGGAAAGGCATCACTATGGACTTTCTCTATTTTAAAA
TGGTAACAATCAGAGGAACTATAAGAACACCTTTAGAAATAAAAATACTGGGATCAAACT
GGCCTGCAAAACCATAGTCAGTTAATTCTTTTTTTCATCCTTCCTCTGAGGGGAAAAACA
AAAAAAAAAAAAAAAAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_000474.3 unedited
GACCAATTGTATACGACTCCTATAGGGCGGCGCGGGAAATCGTCGACTGGATCCGGTACC
GAGGAGATCTGCCGCCGCGATCGCGGCGCGCCAGATCTCAAGCTTAACTAGTTAGCGGAC
CGACGCGTTAAGCGGCCGCGAATTCAGATCCACAAGTTTGTACAAAAAAGCAGGCTTGTA
AAACGACGGCCAGTAACTATAACGGTCCTAAGGTAGCGAGGCCTGGGTGGCGAATTCGGC
ACGAGGGAGGTATAAGAGCCTCCAAGTCTGCAGCTCTCGCCCAACTCCCAGACACCTCGC
GGGCTCTGCAGCACCGGCACCGTTTCCAGTTTTTCTTTGCGGGGTGTGCGTCCAGCCGTT
GGGCGCTTTCTTTTTGGACCTCGGGGCCATCCACACCGTCCCCTCCCCCTCCCGCCTCCC
TCCCCGCCTCCCCCGCGCGCCCTCCCCGCGGAAGTCCCTCCCGTCCGTCCTCCTGCTCTC
TCCTCCGCGGGCCGCATCGCCCCGGGCCGGCGCCGCGCGCGGGGGAAACTGGCGGGCTGA
AGCGCCCCGCTCTTCTCCTCTGCCCCGGGCCCCGCGAGGCCACCGCGTCGCCGCTCGAGA
GATGATGCAGGACGTGTCCAGCTCGCCAGTCCTCGCCCGGCCGACGACAGCCTGAGCAAC
AGCCAAGGAAAAGCCAGAACCGGCAGCAATCTCCGAGCGGCAAGCGGCGGGGGACGCAGC
TGCGCATCAACAAGCGCACGCGGGCGGCGGCCCGGGGCCGGCGGAGCCCCGGTTGGGGGC
GTCGGAGCGGCACAACCCCGGCACCCCGGCCCAAGGCAAGCCCGCAGAATCTTCGTGCTG
TTGCTGCCGACTCGTGCCGGGCAGGCGAGGGGTGGGTCACAACA
Restriction Sites Please inquire     
Tag Tag Free
ACCN NM_000474
ORF Size 609 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_000474.3, NP_000465
RefSeq Size 1669
RefSeq ORF 609
Locus ID 7291
Cytogenetics 7p21.1
Protein Families Druggable Genome
Gene Summary Basic helix-loop-helix (bHLH) transcription factors have been implicated in cell lineage determination and differentiation. The protein encoded by this gene is a bHLH transcription factor and shares similarity with another bHLH transcription factor, Dermo1. The strongest expression of this mRNA is in placental tissue; in adults, mesodermally derived tissues express this mRNA preferentially. Mutations in this gene have been found in patients with Saethre-Chotzen syndrome. [provided by RefSeq, Jul 2008].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations