PPAR gamma (PPARG) (NM_138712) Human Untagged Clone

SKU
SC317792
PPARG (untagged)-Human peroxisome proliferator-activated receptor gamma (PPARG), transcript variant 1
$732.00
2 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol PPAR gamma
Synonyms CIMT1; GLM1; NR1C3; PPARG1; PPARG2; PPARG5; PPARgamma
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC317792 representing NM_138712.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGACCATGGTTGACACAGAGATGCCATTCTGGCCCACCAACTTTGGGATCAGCTCCGTGGATCTCTCC
GTAATGGAAGACCACTCCCACTCCTTTGATATCAAGCCCTTCACTACTGTTGACTTCTCCAGCATTTCT
ACTCCACATTACGAAGACATTCCATTCACAAGAACAGATCCAGTGGTTGCAGATTACAAGTATGACCTG
AAACTTCAAGAGTACCAAAGTGCAATCAAAGTGGAGCCTGCATCTCCACCTTATTATTCTGAGAAGACT
CAGCTCTACAATAAGCCTCATGAAGAGCCTTCCAACTCCCTCATGGCAATTGAATGTCGTGTCTGTGGA
GATAAAGCTTCTGGATTTCACTATGGAGTTCATGCTTGTGAAGGATGCAAGGGTTTCTTCCGGAGAACA
ATCAGATTGAAGCTTATCTATGACAGATGTGATCTTAACTGTCGGATCCACAAAAAAAGTAGAAATAAA
TGTCAGTACTGTCGGTTTCAGAAATGCCTTGCAGTGGGGATGTCTCATAATGCCATCAGGTTTGGGCGG
ATGCCACAGGCCGAGAAGGAGAAGCTGTTGGCGGAGATCTCCAGTGATATCGACCAGCTGAATCCAGAG
TCCGCTGACCTCCGGGCCCTGGCAAAACATTTGTATGACTCATACATAAAGTCCTTCCCGCTGACCAAA
GCAAAGGCGAGGGCGATCTTGACAGGAAAGACAACAGACAAATCACCATTCGTTATCTATGACATGAAT
TCCTTAATGATGGGAGAAGATAAAATCAAGTTCAAACACATCACCCCCCTGCAGGAGCAGAGCAAAGAG
GTGGCCATCCGCATCTTTCAGGGCTGCCAGTTTCGCTCCGTGGAGGCTGTGCAGGAGATCACAGAGTAT
GCCAAAAGCATTCCTGGTTTTGTAAATCTTGACTTGAACGACCAAGTAACTCTCCTCAAATATGGAGTC
CACGAGATCATTTACACAATGCTGGCCTCCTTGATGAATAAAGATGGGGTTCTCATATCCGAGGGCCAA
GGCTTCATGACAAGGGAGTTTCTAAAGAGCCTGCGAAAGCCTTTTGGTGACTTTATGGAGCCCAAGTTT
GAGTTTGCTGTGAAGTTCAATGCACTGGAATTAGATGACAGCGACTTGGCAATATTTATTGCTGTCATT
ATTCTCAGTGGAGACCGCCCAGGTTTGCTGAATGTGAAGCCCATTGAAGACATTCAAGACAACCTGCTA
CAAGCCCTGGAGCTCCAGCTGAAGCTGAACCACCCTGAGTCCTCACAGCTGTTTGCCAAGCTGCTCCAG
AAAATGACAGACCTCAGACAGATTGTCACGGAACACGTGCAGCTACTGCAGGTGATCAAGAAGACGGAG
ACAGACATGAGTCTTCACCCGCTCCTGCAGGAGATCTACAAGGACTTGTACTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_138712
Insert Size 1434 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_138712.3
RefSeq Size 1892 bp
RefSeq ORF 1434 bp
Locus ID 5468
UniProt ID P37231
Cytogenetics 3p25.2
Domains HOLI, zf-C4
Protein Families Druggable Genome, Nuclear Hormone Receptor, Transcription Factors
Protein Pathways Huntington's disease, Pathways in cancer, PPAR signaling pathway, Thyroid cancer
MW 54.7 kDa
Summary This gene encodes a member of the peroxisome proliferator-activated receptor (PPAR) subfamily of nuclear receptors. PPARs form heterodimers with retinoid X receptors (RXRs) and these heterodimers regulate transcription of various genes. Three subtypes of PPARs are known: PPAR-alpha, PPAR-delta, and PPAR-gamma. The protein encoded by this gene is PPAR-gamma and is a regulator of adipocyte differentiation. Additionally, PPAR-gamma has been implicated in the pathology of numerous diseases including obesity, diabetes, atherosclerosis and cancer. Alternatively spliced transcript variants that encode different isoforms have been described. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) differs in the 5' UTR and 5' coding region compared to variant 2. Variants 1, 3, 4, 6, and 7 all encode the same isoform (1), which has a shorter, distinct N-terminus compared to isoform 2.
Write Your Own Review
You're reviewing:PPAR gamma (PPARG) (NM_138712) Human Untagged Clone
Your Rating
SKU Description Size Price
RC201538 PPARG (Myc-DDK-tagged)-Human peroxisome proliferator-activated receptor gamma (PPARG), transcript variant 1 10 ug
$686.00
RC201538L3 Lenti ORF clone of Human peroxisome proliferator-activated receptor gamma (PPARG), transcript variant 1, Myc-DDK-tagged 10 ug
$986.00
RC201538L4 Lenti ORF clone of Human peroxisome proliferator-activated receptor gamma (PPARG), transcript variant 1, mGFP tagged 10 ug
$986.00
RG201538 PPARG (tGFP-tagged) - Human peroxisome proliferator-activated receptor gamma (PPARG), transcript variant 1 10 ug
$886.00
SC124177 PPARG (untagged)-Human peroxisome proliferator-activated receptor gamma (PPARG), transcript variant 1 10 ug
$686.00
SC322218 PPARG (untagged)-Human peroxisome proliferator-activated receptor gamma (PPARG), transcript variant 1 10 ug
$686.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.