Cytochrome b5 Outer Mitochondrial Membrane (CYB5B) (NM_030579) Human Untagged Clone

SKU
SC317248
CYB5B (untagged)-Human cytochrome b5 type B (outer mitochondrial membrane) (CYB5B), nuclear gene encoding mitochondrial protein
$165.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Cytochrome b5 Outer Mitochondrial Membrane
Synonyms CYB5-M; CYPB5M; OMB5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC317248 representing NM_030579.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCCGGTTCAATGGCGACTGCGGAAGCTAGCGGCAGCGATGGGAAAGGGCAGGAAGTCGAGACCTCA
GTCACCTATTACCGGTTGGAGGAGGTGGCAAAGCGCAACTCCTTGAAGGAACTGTGGCTTGTGATCCAT
GGGCGAGTCTACGATGTCACCCGCTTCCTCAACGAGCACCCTGGAGGAGAAGAGGTTCTGCTGGAACAA
GCTGGTGTAGATGCAAGTGAAAGCTTTGAAGATGTAGGACACTCTTCTGATGCCAGAGAAATGCTAAAG
CAGTACTACATTGGTGATATCCATCCGAGTGACCTTAAACCTGAAAGTGGTAGCAAGGACCCTTCAAAA
AATGATACATGCAAAAGTTGCTGGGCATATTGGATTTTACCCATCATAGGCGCTGTTCTCTTAGGTTTC
CTGTACCGCTACTACACATCGGAAAGCAAATCCTCCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_030579
Insert Size 453 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_030579.2
RefSeq Size 4286 bp
RefSeq ORF 453 bp
Locus ID 80777
UniProt ID O43169
Cytogenetics 16q22.1
Domains heme_1
Protein Families Transmembrane
MW 16.7 kDa
Summary Cytochrome b5 is a membrane-bound hemoprotein functioning as an electron carrier for several membrane-bound oxygenases.[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:Cytochrome b5 Outer Mitochondrial Membrane (CYB5B) (NM_030579) Human Untagged Clone
Your Rating
SKU Description Size Price
RC200604 CYB5B (Myc-DDK-tagged)-Human cytochrome b5 type B (outer mitochondrial membrane) (CYB5B), nuclear gene encoding mitochondrial protein 10 ug
$150.00
RC200604L1 Lenti ORF clone of Human cytochrome b5 type B (outer mitochondrial membrane) (CYB5B), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged 10 ug
$450.00
RC200604L2 Lenti ORF clone of Human cytochrome b5 type B (outer mitochondrial membrane) (CYB5B), nuclear gene encoding mitochondrial protein, mGFP tagged 10 ug
$450.00
RC200604L3 Lenti ORF clone of Human cytochrome b5 type B (outer mitochondrial membrane) (CYB5B), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged 10 ug
$450.00
RC200604L4 Lenti ORF clone of Human cytochrome b5 type B (outer mitochondrial membrane) (CYB5B), nuclear gene encoding mitochondrial protein, mGFP tagged 10 ug
$450.00
RG200604 CYB5B (tGFP-tagged) - Human cytochrome b5 type B (outer mitochondrial membrane) (CYB5B), nuclear gene encoding mitochondrial protein 10 ug
$489.00
SC107995 CYB5B (untagged)-Human cytochrome b5 type B (outer mitochondrial membrane) (CYB5B), nuclear gene encoding mitochondrial protein 10 ug
$150.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.