PRMT1 (NM_001536) Human Untagged Clone

SKU
SC309036
PRMT1 (untagged)-Human protein arginine methyltransferase 1 (PRMT1), transcript variant 1
$503.00
2 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol PRMT1
Synonyms ANM1; HCP1; HRMT1L2; IR1B4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC309036 representing NM_001536.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGGCAGCCGAGGCCGCGAACTGCATCATGGAGAATTTTGTAGCCACCTTGGCTAATGGGATGAGC
CTCCAGCCGCCTCTTGAAGAAGTGTCCTGTGGCCAGGCGGAAAGCAGTGAGAAGCCCAACGCTGAGGAC
ATGACATCCAAAGATTACTACTTTGACTCCTACGCACACTTTGGCATCCACGAGGAGATGCTGAAGGAC
GAGGTGCGCACCCTCACTTACCGCAACTCCATGTTTCATAACCGGCACCTCTTCAAGGACAAGGTGGTG
CTGGACGTCGGCTCGGGCACCGGCATCCTCTGCATGTTTGCTGCCAAGGCCGGGGCCCGCAAGGTCATC
GGGATCGAGTGTTCCAGTATCTCTGATTATGCGGTGAAGATCGTCAAAGCCAACAAGTTAGACCACGTG
GTGACCATCATCAAGGGGAAGGTGGAGGAGGTGGAGCTCCCAGTGGAGAAGGTGGACATCATCATCAGC
GAGTGGATGGGCTACTGCCTCTTCTACGAGTCCATGCTCAACACCGTGCTCTATGCCCGGGACAAGTGG
CTGGCGCCCGATGGCCTCATCTTCCCAGACCGGGCCACGCTGTATGTGACGGCCATCGAGGACCGGCAG
TACAAAGACTACAAGATCCACTGGTGGGAGAACGTGTATGGCTTCGACATGTCTTGCATCAAAGATGTG
GCCATTAAGGAGCCCCTAGTGGATGTCGTGGACCCCAAACAGCTGGTCACCAACGCCTGCCTCATAAAG
GAGGTGGACATCTATACCGTCAAGGTGGAAGACCTGACCTTCACCTCCCCGTTCTGCCTGCAAGTGAAG
CGGAATGACTACGTGCACGCCCTGGTGGCCTACTTCAACATCGAGTTCACACGCTGCCACAAGAGGACC
GGCTTCTCCACCAGCCCCGAGTCCCCGTACACGCACTGGAAGCAGACGGTGTTCTACATGGAGGACTAC
CTGACCGTGAAGACGGGCGAGGAGATCTTCGGCACCATCGGCATGCGGCCCAACGCCAAGAACAACCGG
GACCTGGACTTCACCATCGACCTGGACTTCAAGGGCCAGCTGTGCGAGCTGTCCTGCTCCACCGACTAC
CGGATGCGCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001536
Insert Size 1116 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001536.5
RefSeq Size 1450 bp
RefSeq ORF 1116 bp
Locus ID 3276
UniProt ID Q99873
Cytogenetics 19q13.33
MW 42.5 kDa
Summary This gene encodes a member of the protein arginine N-methyltransferase (PRMT) family. Post-translational modification of target proteins by PRMTs plays an important regulatory role in many biological processes, whereby PRMTs methylate arginine residues by transferring methyl groups from S-adenosyl-L-methionine to terminal guanidino nitrogen atoms. The encoded protein is a type I PRMT and is responsible for the majority of cellular arginine methylation activity. Increased expression of this gene may play a role in many types of cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 5. [provided by RefSeq, Dec 2011]
Transcript Variant: This variant (1) encodes the longest isoform (1).
Write Your Own Review
You're reviewing:PRMT1 (NM_001536) Human Untagged Clone
Your Rating
SKU Description Size Price
RC224239 PRMT1 (Myc-DDK-tagged)-Human protein arginine methyltransferase 1 (PRMT1), transcript variant 1 10 ug
$457.00
RC224239L1 Lenti ORF clone of Human protein arginine methyltransferase 1 (PRMT1), transcript variant 1, Myc-DDK-tagged 10 ug
$757.00
RC224239L2 Lenti ORF clone of Human protein arginine methyltransferase 1 (PRMT1), transcript variant 1, mGFP tagged 10 ug
$757.00
RC224239L3 Lenti ORF clone of Human protein arginine methyltransferase 1 (PRMT1), transcript variant 1, Myc-DDK-tagged 10 ug
$757.00
RC224239L4 Lenti ORF clone of Human protein arginine methyltransferase 1 (PRMT1), transcript variant 1, mGFP tagged 10 ug
$757.00
RG224239 PRMT1 (tGFP-tagged) - Human protein arginine methyltransferase 1 (PRMT1), transcript variant 1 10 ug
$489.00 MSRP $657.00 MSRP $657.00
SC317596 PRMT1 (untagged)-Human protein arginine methyltransferase 1 (PRMT1), transcript variant 1 10 ug
$457.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.