S100A5 (NM_002962) Human Untagged Clone

SKU SC303255

S100A5 (untagged)-Human S100 calcium binding protein A5 (S100A5)

Product Data

• Type: Human Untagged Clone
• Target Symbol: S100A5
• Synonyms: S100D
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC303255 representing NM_002962.; Blue=Insert sequence Red=Cloning site Green=Tag(s); ; GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG; GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC; ATGGAGACTCCTCTGGAGAAGGCCCTGACCACTATGGTGACCACGTTTCACAAATATTCGGGGAGAGAG; GGTAGCAAACTGACCCTGAGTAGGAAGGAACTCAAGGAGCTGATCAAGAAAGAGCTGTGTCTTGGGGAG; ATGAAGGAGAGCAGCATCGATGACTTGATGAAGAGCCTGGACAAGAACAGCGACCAGGAGATCGACTTC; AAGGAGTACTCGGTGTTCCTGACCATGCTGTGCATGGCCTACAACGACTTCTTTCTAGAGGACAACAAG; TGA; ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT; TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC;
• Restriction Sites: SgfI-MluI
• ACCN: NM_002962
• Insert Size: 279 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_002962.1
• RefSeq Size: 710 bp
• RefSeq ORF: 279 bp
• Locus ID: 6276
• UniProt ID: P33763
• Cytogenetics: 1q21.3
• MW: 10.7 kDa
• Summary: The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21. This protein has a Ca2+ affinity 20- to 100-fold higher than the other S100 proteins studied under identical conditions. This protein also binds Zn2+ and Cu2+, and Cu2+ strongly which impairs the binding of Ca2+. This protein is expressed in very restricted regions of the adult brain. [provided by RefSeq, Jul 2008]