RBFOX2 (NM_001031695) Human Untagged Clone

SKU
SC302541
RBFOX2 (untagged)-Human RNA binding protein, fox-1 homolog (C. elegans) 2 (RBFOX2), transcript variant 1
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol RBFOX2
Synonyms dJ106I20.3; Fox-2; FOX2; fxh; HNRBP2; HRNBP2; RBM9; RTA
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC302541 representing NM_001031695.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAGAAAAAGAAAATGGTAACTCAGGGTAACCAGGAGCCGACAACAACTCCTGACGCAATGGTTCAG
CCTTTTACTACCATCCCATTTCCACCACCTCCGCAGAATGGAATTCCCACAGAGTATGGGGTGCCACAC
ACTCAAGACTATGCCGGCCAGACCGGTGAGCATAACCTGACACTCTACGGAAGTACGCAAGCCCACGGG
GAGCAGAGCAGCAACTCACCCAGCACACAAAATGGATCTCTTACGACAGAAGGTGGAGCACAGACAGAC
GGCCAGCAGTCACAGACACAAAGTAGTGAAAATTCAGAGAGTAAATCTACCCCGAAACGGCTGCATGTC
TCTAATATTCCTTTCCGCTTCCGGGACCCTGACCTCCGGCAGATGTTTGGGCAGTTTGGCAAAATCCTA
GATGTAGAAATAATCTTTAATGAACGTGGCTCTAAGGGATTCGGGTTCGTAACTTTCGAGAATAGTGCT
GATGCAGACAGGGCCAGGGAGAAATTACACGGCACCGTGGTAGAGGGCCGTAAAATCGAGGTGAATAAT
GCTACAGCACGTGTAATGACCAATAAGAAGATGGTCACACCATATGCAAATGGTTGGAAATTAAGCCCA
GTAGTTGGAGCTGTATATGGTCCGGAGTTATATGCAGCATCCAGCTTTCAAGCAGATGTGTCCCTAGGC
AATGATGCAGCAGTGCCCCTATCAGGAAGAGGGGGTATCAACACTTACATTCCTTTAATCAGTCTCCCT
TTAGTTCCTGGCTTCCCTTACCCTACTGCAGCCACCACGGCAGCCGCTTTCAGAGGAGCCCATTTGAGG
GGCAGAGGGCGGACAGTATATGGTGCAGTCCGAGCGGTACCTCCAACAGCCATCCCCGCCTATCCAGGT
GTGGTTTACCAGGACGGATTTTACGGTGCTGACCTCTATGGTGGATATGCAGCCTACAGATATGCACAG
CCTGCTACTGCAACCGCAGCCACCGCTGCTGCAGCCGCTGCAGCCGCTTACAGTGACGGTTATGGCAGG
GTGTACACAGCCGACCCCTACCATGCCCTTGCCCCTGCCGCTAGCTATGGAGTTGGCGCTGTGGCGAGT
TTATACCGAGGTGGCTACAGCCGATTTGCCCCCTACTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001031695
Insert Size 1143 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001031695.2
RefSeq Size 6997 bp
RefSeq ORF 1143 bp
Locus ID 23543
UniProt ID O43251
Cytogenetics 22q12.3
Protein Families Druggable Genome, Transcription Factors
MW 40.4 kDa
Summary This gene is one of several human genes similar to the C. elegans gene Fox-1. This gene encodes an RNA binding protein that is thought to be a key regulator of alternative exon splicing in the nervous system and other cell types. The protein binds to a conserved UGCAUG element found downstream of many alternatively spliced exons and promotes inclusion of the alternative exon in mature transcripts. The protein also interacts with the estrogen receptor 1 transcription factor and regulates estrogen receptor 1 transcriptional activity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) encodes isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.
Write Your Own Review
You're reviewing:RBFOX2 (NM_001031695) Human Untagged Clone
Your Rating
SKU Description Size Price
RC206846 RBFOX2 (Myc-DDK-tagged)-Human RNA binding protein, fox-1 homolog (C. elegans) 2 (RBFOX2), transcript variant 1 10 ug
$289.00 MSRP $457.00 MSRP $457.00
RC206846L1 Lenti ORF clone of Human RNA binding protein, fox-1 homolog (C. elegans) 2 (RBFOX2), transcript variant 1, Myc-DDK-tagged 10 ug
$757.00
RC206846L2 Lenti ORF clone of Human RNA binding protein, fox-1 homolog (C. elegans) 2 (RBFOX2), transcript variant 1, mGFP tagged 10 ug
$757.00
RC206846L3 Lenti ORF clone of Human RNA binding protein, fox-1 homolog (C. elegans) 2 (RBFOX2), transcript variant 1, Myc-DDK-tagged 10 ug
$757.00
RC206846L4 Lenti ORF clone of Human RNA binding protein, fox-1 homolog (C. elegans) 2 (RBFOX2), transcript variant 1, mGFP tagged 10 ug
$757.00
RG206846 RBFOX2 (tGFP-tagged) - Human RNA binding protein, fox-1 homolog (C. elegans) 2 (RBFOX2), transcript variant 1 10 ug
$489.00 MSRP $657.00 MSRP $657.00
SC320568 RBFOX2 (untagged)-Human RNA binding protein, fox-1 homolog (C. elegans) 2 (RBFOX2), transcript variant 1 10 ug
$457.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.