MAP1LC3A (NM_032514) Human Untagged Clone

SKU
SC111851
MAP1LC3A (untagged)-Human microtubule-associated protein 1 light chain 3 alpha (MAP1LC3A), transcript variant 1
$150.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol MAP1LC3A
Synonyms ATG8E; LC3; LC3A; MAP1ALC3; MAP1BLC3
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC111851 sequence for NM_032514 edited (data generated by NextGen Sequencing)
ATGCCCTCAGACCGGCCTTTCAAGCAGCGGCGGAGCTTCGCCGACCGCTGTAAGGAGGTA
CAGCAGATCCGCGACCAGCACCCCAGCAAAATCCCGGTGATCATCGAGCGCTACAAGGGT
GAGAAGCAGCTGCCCGTCCTGGACAAGACCAAGTTTTTGGTCCCGGACCATGTCAACATG
AGCGAGTTGGTCAAGATCATCCGGCGCCGCCTGCAGCTGAACCCCACGCAGGCCTTCTTC
CTGCTGGTGAACCAGCACAGCATGGTGAGTGTGTCCACGCCCATCGCGGACATCTACGAG
CAGGAGAAAGACGAGGACGGCTTCCTCTATATGGTCTACGCCTCCCAGGAAACCTTCGGC
TTCTGA

Clone variation with respect to NM_032514.2
5' Read Nucleotide Sequence
>OriGene 5' read for NM_032514 unedited
TCACATATTGTAATACGAACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGCCGGAGC
CCCCAAACCGCAGACACATCCCCGCGCCCCAGAGCCCCGGCCTGCGCGCCCAGCCGGGCC
CGCGCGATGCCCTCAGACCGGCCTTTCAAGCAGCGGCGGAGCTTCGCCGACCGCTGTAAG
GAGGTACAGCAGATCCGCGACCAGCACCCCAGCAAAATCCCGGTGATCATCGAGCGCTAC
AAGGGTGAGAAGCAGCTGCCCGTCCTGGACAAGACCAAGTTTTTGGTCCCGGACCATGTC
AACATGAGCGAGTTGGTCAAGATCATCCGGCGCCGCCTGCAGCTGAACCCCACGCAGGCC
TTCTTCCTGCTGGTGAACCAGCACAGCATGGTGAGTGTGTCCACGCCCATCGCGGACATC
TACGAGCAGGAGAAAGACGAGGACGGCTTCCTCTATATGGTCTACGCCTCCCAGGAAACC
TTCGGCTTCTGAGCCAGCAGTAGGGGGGCTCGGCCTGGGAGTCGGGGGGCCCCGGTCAGG
CCCTGCCCAGAGAGCTCCTGGTTCCTGAACTGAGCTGCCTCTACCGTGGTGGGCTGGGCA
GGCATGTGCCCCCCTAGTCAGAGGGCACCAACCCACCTACTCTGCCCCTGNGTGGATCCT
GNGCCGGTCGTGTTAGGGTTGTCCCTCTGGGTGCTGGCTGGTGGGATGGGGANNGGTGGG
GGAGCAACTTCCAGCACCCCTGCTGTGTGGTTCATCTTTTTTTTAGGCCCCTGCCTGTCT
GCCCATCTGGCCCCTCACCCACCCCGAGCTCTGCCCACCGCNTGGNACCTGCCCCACCCC
TGAAAAGACTGGCCCCCTGGCTCCCGNCCCCTCGGGTCTCACGTGGNNGTAATGGATCTG
TGGGTCATTGGNCCCTCTTGCANAATAAAGATTGCTCAGCCCTGCCCTGGCCCTGTGAAA
NNAAANNAANNNNNNNNNNANTAATTAACACACAAAAA
Restriction Sites NotI-NotI
ACCN NM_032514
Insert Size 1020 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_032514.2, NP_115903.1
RefSeq Size 1030 bp
RefSeq ORF 366 bp
Locus ID 84557
UniProt ID Q9H492
Cytogenetics 20q11.22
Domains MAP1_LC3
Summary MAP1A and MAP1B are microtubule-associated proteins which mediate the physical interactions between microtubules and components of the cytoskeleton. MAP1A and MAP1B each consist of a heavy chain subunit and multiple light chain subunits. The protein encoded by this gene is one of the light chain subunits and can associate with either MAP1A or MAP1B. Two transcript variants encoding different isoforms have been found for this gene. The expression of variant 1 is suppressed in many tumor cell lines, suggesting that may be involved in carcinogenesis. [provided by RefSeq, Feb 2012]
Transcript Variant: This variant (1) encodes the predominant isoform (a).
Write Your Own Review
You're reviewing:MAP1LC3A (NM_032514) Human Untagged Clone
Your Rating
SKU Description Size Price
RC202222 MAP1LC3A (Myc-DDK-tagged)-Human microtubule-associated protein 1 light chain 3 alpha (MAP1LC3A), transcript variant 1 10 ug
$289.00
RC202222L1 Lenti ORF clone of Human microtubule-associated protein 1 light chain 3 alpha (MAP1LC3A), transcript variant 1, Myc-DDK-tagged 10 ug
$450.00
RC202222L2 Lenti ORF clone of Human microtubule-associated protein 1 light chain 3 alpha (MAP1LC3A), transcript variant 1, mGFP tagged 10 ug
$450.00
RC202222L3 Lenti ORF clone of Human microtubule-associated protein 1 light chain 3 alpha (MAP1LC3A), transcript variant 1, Myc-DDK-tagged 10 ug
$450.00
RC202222L4 Lenti ORF clone of Human microtubule-associated protein 1 light chain 3 alpha (MAP1LC3A), transcript variant 1, mGFP tagged 10 ug
$450.00
RG202222 MAP1LC3A (tGFP-tagged) - Human microtubule-associated protein 1 light chain 3 alpha (MAP1LC3A), transcript variant 1 10 ug
$489.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.