Pdx1 (NM_008814) Mouse Tagged ORF Clone

SKU
MR227421
Pdx1 (Myc-DDK-tagged) - Mouse pancreatic and duodenal homeobox 1 (Pdx1)
  • TrueORF®
    TrueORF®

    Expression-ready ORF plasmid with C-terminal tag(s)

    Click here to learn more.

$289.00 MSRP $300.00 MSRP $300.00
In Stock*
Specifications
Product Data
Type Mouse Tagged ORF Clone
Target Symbol Pdx1
Synonyms IDX-1; IPF-1; Ipf1; Mody4; pdx-1; STF-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
ORF Nucleotide Sequence
>MR227421 representing NM_008814
Red=Cloning site Blue=ORF Green=Tags(s)

CTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAACAGTGAGGAGCAGTACTACGCGGCCACACAGCTCTACAAGGACCCGTGCGCATTCCAGAGGGGCC
CGGTGCCAGAGTTCAGCGCTAACCCCCCTGCGTGCCTGTACATGGGCCGCCAGCCCCCACCTCCGCCGCC
ACCCCAGTTTACAAGCTCGCTGGGATCACTGGAGCAGGGAAGTCCTCCGGACATCTCCCCATACGAAGTG
CCCCCGCTCGCCTCCGACGACCCGGCTGGCGCTCACCTCCACCACCACCTTCCAGCTCAGCTCGGGCTCG
CCCATCCACCTCCCGGACCTTTCCCGAATGGAACCGAGCCTGGGGGCCTGGAAGAGCCCAACCGCGTCCA
GCTCCCTTTCCCGTGGATGAAATCCACCAAAGCTCACGCGTGGAAAGGCCAGTGGGCAGGAGGTGCTTAC
ACAGCGGAACCCGAGGAAAACAAGAGGACCCGTACTGCCTACACCCGGGCGCAGCTGCTGGAGCTGGAGA
AGGAATTCTTATTTAACAAATACATCTCCCGGCCCCGCCGGGTGGAGCTGGCAGTGATGTTGAACTTGAC
CGAGAGACACATCAAAATCTGGTTCCAAAACCGTCGCATGAAGTGGAAAAAAGAGGAAGATAAGAAACGT
AGTAGCGGGACCCCGAGTGGGGGCGGTGGGGGCGAAGAGCCGGAGCAAGATTGTGCGGTGACCTCGGGCG
AGGAGCTGCTGGCAGTGCCACCGCTGCCACCTCCCGGAGGTGCCGTGCCCCCAGGCGTCCCAGCTGCAGT
CCGGGAGGGCCTACTGCCTTCGGGCCTTAGCGTGTCGCCACAGCCCTCCAGCATCGCGCCACTGCGACCG
CAGGAACCCCGG


AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-RsrII Cloning Scheme for this gene Plasmid Map
ACCN NM_008814
ORF Size 852 bp
OTI Disclaimer The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_008814.4
RefSeq Size 1287 bp
RefSeq ORF 855 bp
Locus ID 18609
UniProt ID P52946
Cytogenetics 5 86.84 cM
MW 31.4 kDa
Summary Activates insulin and somatostatin gene transcription. Key regulator of islet peptide hormone expression but also responsible for the development of the pancreas, most probably by determining maturation and differentiation of common pancreatic precursor cells in the developing gut. As part of a PDX1:PBX1b:MEIS2b complex in pancreatic acinar cells is involved in the transcriptional activation of the ELA1 enhancer; the complex binds to the enhancer B element and cooperates with the transcription factor 1 complex (PTF1) bound to the enhancer A element. Binds the DNA sequence 5'-CC[CT]TAATGGG-3'.[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:Pdx1 (NM_008814) Mouse Tagged ORF Clone
Your Rating
SKU Description Size Price
MC209160 Pdx1 (untagged) - Mouse pancreatic and duodenal homeobox 1 (Pdx1), (10ug) 10 ug
$330.00
MG227421 Pdx1 (tGFP-tagged) - Mouse pancreatic and duodenal homeobox 1 (Pdx1), (10ug) 10 ug
$489.00 MSRP $500.00 MSRP $500.00
MR227421L1 Lenti ORF clone of Pdx1 (Myc-DDK-tagged) - Mouse pancreatic and duodenal homeobox 1 (Pdx1) 10 ug
$600.00
MR227421L2 Lenti ORF clone of Pdx1 (mGFP-tagged) - Mouse pancreatic and duodenal homeobox 1 (Pdx1) 10 ug
$600.00
MR227421L3 Lenti ORF clone of Pdx1 (Myc-DDK-tagged) - Mouse pancreatic and duodenal homeobox 1 (Pdx1) 10 ug
$600.00
MR227421L4 Lenti ORF clone of Pdx1 (mGFP-tagged) - Mouse pancreatic and duodenal homeobox 1 (Pdx1) 10 ug
$600.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.