Gapdh Mouse qPCR Primer Pair (NM_008084)

CAT#: MP205604

Reviews ()
Write a review

qSTAR qPCR primer pairs against Mus musculus gene Gapdh



SensiMix SYBR Master Mix

USD 120.00


Availability*
In Stock

Size
    • 200 reactions

Product images

Specifications

Product Data
Gene ID 14433
Forward Sequence CATCACTGCCACCCAGAAGACTG
Reverse Sequence ATGCCAGTGAGCTTCCCGTTCAG
Accession No BC083065, BC083079, BC083080, BC083149, BC085274, BC085275, BC085315, BC091768, BC092252, BC092264, BC092267, BC092294, BC093508, BC094037, BC095932, BC096042, BC096440, BC096590, BC110311, NM_001289726, NM_008084, BC020407, BC023196, BC091736, BC145810, BC145812, BI851476, BU504528
Synonyms Gapd
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT
Storage The primer mix is stable for one year from date of shipping. Store at -20°C.

Citations (7)

Other products for "Gapdh"
Frequently bought together (6)
Gapdh (myc-DDK-tagged) - Mouse glyceraldehyde-3-phosphate dehydrogenase (Gapdh), transcript variant 1
    • 10 ug

USD 380.00


First Strand cDNA Synthesis Kit (11801-025)
    • 25 reactions

USD 140.00


First Strand cDNA Synthesis Kit (11801-100)
    • 100 reactions

USD 440.00


Gapdh (Myc-DDK-tagged) - Mouse glyceraldehyde-3-phosphate dehydrogenase (cDNA clone MGC:103188 IMAGE:4159824)
    • 10 ug

USD 350.00


Gapdh (Myc-DDK-tagged) - Mouse glyceraldehyde-3-phosphate dehydrogenase (cDNA clone MGC:107018 IMAGE:1067416)
    • 10 ug

USD 200.00


Gapdh (Myc-DDK-tagged) - Mouse glyceraldehyde-3-phosphate dehydrogenase (Gapdh)
    • 10 ug

USD 68.00 USD 269.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones
Molbio tools