Gapdh Mouse qPCR Primer Pair (NM_008084)

SKU MP205604

qSTAR qPCR primer pairs against Mus musculus gene Gapdh

Product Data

• Locus ID: 14433
• Forward Sequence: CATCACTGCCACCCAGAAGACTG
• Reverse Sequence: ATGCCAGTGAGCTTCCCGTTCAG
• ACCN: BC083065, BC083079, BC083080, BC083149, BC085274, BC085275, BC085315, BC091768, BC092252, BC092264, BC092267, BC092294, BC093508, BC094037, BC095932, BC096042, BC096440, BC096590, BC110311, NM_008084, NM_008084.1, NM_008084.2, NM_008084.3, BC091768.1, BC096042.1, BC020407, BC023196, BC091736, BC145810, BC145812, BI851476, BU504528
• UniProt ID: P16858
• Synonyms: Ga; Gapd
• Components: 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
• Quality Control: The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
• Storage: Store at -20°C.
• Stability: The primer mix is stable for one year from date of shipping.
• Shipping: Ambient