Gapdh Mouse qPCR Primer Pair (NM_008084)
USD 142.00
2 Weeks*
Size
Product Images

Frequently bought together (4)
Gapdh (Myc-DDK-tagged) - Mouse glyceraldehyde-3-phosphate dehydrogenase (Gapdh)
USD 300.00
Other products for "Gapdh"
Specifications
Product Data | |
Gene ID | 14433 |
Forward Sequence | CATCACTGCCACCCAGAAGACTG |
Reverse Sequence | ATGCCAGTGAGCTTCCCGTTCAG |
Accession No | BC083065, BC083079, BC083080, BC083149, BC085274, BC085275, BC085315, BC091768, BC092252, BC092264, BC092267, BC092294, BC093508, BC094037, BC095932, BC096042, BC096440, BC096590, BC110311, NM_008084, NM_008084.1, NM_008084.2, NM_008084.3, BC091768.1, BC096042.1, BC020407, BC023196, BC091736, BC145810, BC145812, BI851476, BU504528 |
UniProt ID | P16858 |
Synonyms | Ga; Gapd |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.