Gapdh Mouse qPCR Primer Pair (NM_008084)

CAT#: MP205604

qSTAR qPCR primer pairs against Mus musculus gene Gapdh

 Cited in 6 publications.

USD 100.00


Availability*
2 Weeks

Size
    • 200 rxns

Product images

Specifications

Product Data
Gene ID 14433
Forward Sequence CATCACTGCCACCCAGAAGACTG
Reverse Sequence ATGCCAGTGAGCTTCCCGTTCAG
Accession No BC083065, BC083079, BC083080, BC083149, BC085274, BC085275, BC085315, BC091768, BC092252, BC092264, BC092267, BC092294, BC093508, BC094037, BC095932, BC096042, BC096440, BC096590, BC110311, NM_001289726, NM_008084, BC020407, BC023196, BC091736, BC145810, BC145812, BI851476, BU504528
Synonyms Gapd
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT
Storage & Stability The primer mix is stable for one year from date of shipping. Store at -20°C.

Citations (6)

Other products for "Gapdh"
Frequently bought together (1)
Gapdh (Myc-DDK-tagged) - Mouse glyceraldehyde-3-phosphate dehydrogenase (Gapdh)
    • 10 ug

USD 68.00 USD 269.00

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
40% off proteins and antibodies
68 Mouse Clones