MIR384 Human qPCR Primer Pair (MI0001145)
$189.00
3 Days*
| Product Data | |
| Locus ID | 494333 |
|---|---|
| Forward Sequence | ATTCCTAGAAATTGTTCATA |
| Reverse Sequence | GAACATGTCTGCGTATCTC |
| ACCN | MIMAT0001075 |
| Synonyms | hsa-miR-384; MI0001145; MIMAT0001075; MIR384 hsa-mir-384 |
| Components | 1 vial of lyophilized qSTAR miRNA primer mix (1 nmol each primer, sufficient for 200 reactions) |
| Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
| Storage | The primer mix is stable for one year from date of shipping. Store at -20°C. |
| Shipping | Blue Ice |
Write Your Own Review
| Product Manuals |
| FAQs |
Related Products
Check items to add to the cart or
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.