Nav1.5 (SCN5A) Human qPCR Primer Pair (NM_198056)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
SCN5A (Myc-DDK-tagged)-Human sodium channel, voltage-gated, type V, alpha subunit (SCN5A), transcript variant 1
USD 1,664.00
Other products for "SCN5A"
Specifications
Product Data | |
Gene ID | 6331 |
Forward Sequence | CAAGACCTGCTACCACATCGTG |
Reverse Sequence | GTCGGCATACTCAAGCAGAACC |
Accession No | NM_198056, NM_198056.1, NM_198056.2, BC140813, BC051374, BC144621, BU845010, NM_198056.3 |
UniProt ID | Q14524 |
Synonyms | CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1; ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1 |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.