PHC2 Human qPCR Primer Pair (NM_198040)

SKU
HP233353
qSTAR qPCR primer pairs against Homo sapiens gene PHC2
$142.00
5 Days*
Specifications
Product Data
Locus ID 1912
Forward Sequence TCAACGCAGGTTCCAGCACACT
Reverse Sequence CGTCTCAGGCACACTTTTCTCC
ACCN NM_198040, NM_198040.1, NM_198040.2, BC015450, BC018602, BC028396, BC029269, BC068573, BC092492, BC110863, BC130630, BC144121, BX537498
UniProt ID Q8IXK0
Synonyms EDR2; HPH2; PH2
Components 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage Store at -20°C.
Stability The primer mix is stable for one year from date of shipping.
Shipping Ambient
Write Your Own Review
You're reviewing:PHC2 Human qPCR Primer Pair (NM_198040)
Your Rating

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.