NFkB p100 / p52 (NFKB2) Human qPCR Primer Pair (NM_002502)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
NFKB2 (Myc-DDK-tagged)-Human nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100) (NFKB2), transcript variant 2
USD 823.00
Other products for "NFKB2"
Specifications
Product Data | |
Gene ID | 4791 |
Forward Sequence | GGCAGACCAGTGTCATTGAGCA |
Reverse Sequence | CAGCAGAAAGCTCACCACACTC |
Accession No | NM_002502, NM_002502.1, NM_002502.2, NM_002502.3, NM_002502.4, NM_002502.5, BC002844, BC002844.2, BT009769, BY799958, NM_002502.6 |
UniProt ID | Q00653 |
Synonyms | CVID10; H2TF1; LYT-10; LYT10; NF-kB2; p49/p100; p52; p100 |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.