CCR11 (ACKR4) Human qPCR Primer Pair (NM_178445)

SKU
HP228352
qSTAR qPCR primer pairs against Homo sapiens gene ACKR4
$142.00
5 Days*
Specifications
Product Data
Locus ID 51554
Forward Sequence GTCTCTGGAATGCAGTTTCTGGC
Reverse Sequence GGTATGCTCAGCAAGATGGCAG
ACCN NM_178445, NM_178445.1, NM_178445.2, BC069438, BC069438.1, BC095501, BQ015927
UniProt ID Q9NPB9
Synonyms CC-CKR-11; CCBP2; CCR-11; CCR10; CCR11; CCRL1; CCX-CKR; CCX CKR; CKR-11; PPR1; VSHK1
Components 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage Store at -20°C.
Stability The primer mix is stable for one year from date of shipping.
Shipping Ambient
Write Your Own Review
You're reviewing:CCR11 (ACKR4) Human qPCR Primer Pair (NM_178445)
Your Rating

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.