SIPA1 Human qPCR Primer Pair (NM_153253)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
SIPA1 (Myc-DDK-tagged)-Human signal-induced proliferation-associated 1 (SIPA1), transcript variant 1
USD 907.00
Other products for "SIPA1"
Specifications
Product Data | |
Gene ID | 6494 |
Forward Sequence | GTGTCCACGATGCTGCCTTACA |
Reverse Sequence | CTTGCTGCCAGGCTCCTGGAA |
Accession No | NM_153253, NM_153253.1, NM_153253.10, NM_153253.11, NM_153253.12, NM_153253.13, NM_153253.14, NM_153253.15, NM_153253.16, NM_153253.17, NM_153253.18, NM_153253.19, NM_153253.2, NM_153253.20, NM_153253.22, NM_153253.23, NM_153253.24, NM_153253.25, NM_153253.26, NM_153253.27, NM_153253.28, NM_153253.29, NM_153253.3, NM_153253.4, NM_153253.5, NM_153253.6, NM_153253.7, NM_153253.8, NM_153253.9, BC010492, BC010492.1, BC110353, BC110353.1, BM677738 |
UniProt ID | Q96FS4 |
Synonyms | SPA1 |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.