SIPA1 Human qPCR Primer Pair (NM_153253)

SKU HP227453

qSTAR qPCR primer pairs against Homo sapiens gene SIPA1

Product Data

• Locus ID: 6494
• Forward Sequence: GTGTCCACGATGCTGCCTTACA
• Reverse Sequence: CTTGCTGCCAGGCTCCTGGAA
• ACCN: NM_153253, NM_153253.1, NM_153253.10, NM_153253.11, NM_153253.12, NM_153253.13, NM_153253.14, NM_153253.15, NM_153253.16, NM_153253.17, NM_153253.18, NM_153253.19, NM_153253.2, NM_153253.20, NM_153253.22, NM_153253.23, NM_153253.24, NM_153253.25, NM_153253.26, NM_153253.27, NM_153253.28, NM_153253.29, NM_153253.3, NM_153253.4, NM_153253.5, NM_153253.6, NM_153253.7, NM_153253.8, NM_153253.9, BC010492, BC010492.1, BC110353, BC110353.1, BM677738
• UniProt ID: Q96FS4
• Synonyms: SPA1
• Components: 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
• Quality Control: The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
• Storage: Store at -20°C.
• Stability: The primer mix is stable for one year from date of shipping.
• Shipping: Ambient