Glutamine Synthetase (GLUL) Human qPCR Primer Pair (NM_002065)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
GLUL (Myc-DDK-tagged)-Human glutamate-ammonia ligase (GLUL), transcript variant 1
USD 457.00
Other products for "GLUL"
Specifications
Product Data | |
Gene ID | 2752 |
Forward Sequence | CTGCCATACCAACTTCAGCACC |
Reverse Sequence | ATAGGCACGGATGTGGTACTGG |
Accession No | NM_002065, NM_002065.1, NM_002065.2, NM_002065.3, NM_002065.4, NM_002065.5, NM_002065.6, BC011700, BC011700.2, BC018992, BC018992.1, BC011852, BC011852.2, BC010037, BC031964, BC051726, BC127883, BF923451, BG771732, BI668874, BM662182, BM690132, BQ637044, BX537384 |
UniProt ID | P15104 |
Synonyms | GLNS; GS; PIG43; PIG59 |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.