Glutamine Synthetase (GLUL) Human qPCR Primer Pair (NM_002065)

SKU HP227303

qSTAR qPCR primer pairs against Homo sapiens gene GLUL

Product Data

• Locus ID: 2752
• Forward Sequence: CTGCCATACCAACTTCAGCACC
• Reverse Sequence: ATAGGCACGGATGTGGTACTGG
• ACCN: NM_002065, NM_002065.1, NM_002065.2, NM_002065.3, NM_002065.4, NM_002065.5, NM_002065.6, BC011700, BC011700.2, BC018992, BC018992.1, BC011852, BC011852.2, BC010037, BC031964, BC051726, BC127883, BF923451, BG771732, BI668874, BM662182, BM690132, BQ637044, BX537384
• UniProt ID: P15104
• Synonyms: GLNS; GS; PIG43; PIG59
• Components: 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
• Quality Control: The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
• Storage: Store at -20°C.
• Stability: The primer mix is stable for one year from date of shipping.
• Shipping: Ambient