PDCD10 Human qPCR Primer Pair (NM_007217)

CAT#: HP209981

Reviews ()
Write a review

qSTAR qPCR primer pairs against Homo sapiens gene PDCD10



SensiMix SYBR Master Mix

USD 120.00


Availability*
5 Days

Size
    • 200 reactions

Product images

Specifications

Product Data
Gene ID 11235
Forward Sequence CAGACACTGAGAGCCGCTTTCA
Reverse Sequence CTGCCATACGAAGAAGGGACTC
Accession No NM_007217, NM_145859, NM_145860, BC002506, BC016353, NM_007217.4
Synonyms CCM3; TFAR15
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT
Storage The primer mix is stable for one year from date of shipping. Store at -20°C.
Other products for "PDCD10"
Frequently bought together (6)
Anti-PDCD10 Rabbit Polyclonal Antibody
    • 100 ul

USD 345.00


PDCD10 (Myc-DDK-tagged)-Human programmed cell death 10 (PDCD10), transcript variant 2
    • 10 ug

USD 98.00


First Strand cDNA Synthesis Kit (11801-025)
    • 25 reactions

USD 140.00


First Strand cDNA Synthesis Kit (11801-100)
    • 100 reactions

USD 440.00


PDCD10 (Myc-DDK-tagged)-Human programmed cell death 10 (PDCD10), transcript variant 3
    • 10 ug

USD 98.00 USD 390.00


PDCD10 (Myc-DDK-tagged)-Human programmed cell death 10 (PDCD10), transcript variant 1
    • 10 ug

USD 98.00 USD 390.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Molbio tools