RACK1 Human qPCR Primer Pair (NM_006098)

SKU HP209106

qSTAR qPCR primer pairs against Homo sapiens gene RACK1

Product Data

• Locus ID: 10399
• Forward Sequence: GCCATACCAAGGATGTGCTGAG
• Reverse Sequence: CACAAGACACCCACTCTGAGTG
• ACCN: NM_006098, NM_006098.1, NM_006098.2, NM_006098.3, NM_006098.4, BC021993, BC021993.1, BC000214, BC000366, BC010119, BC014256, BC014582, BC014788, BC017287, BC019093, BC019362, BC029996, BC032006, BC035460, NM_006098.5
• UniProt ID: P63244
• Synonyms: Gnb2-rs1; GNB2L1; H12.3; HLC-7; PIG21
• Components: 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
• Quality Control: The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
• Storage: Store at -20°C.
• Stability: The primer mix is stable for one year from date of shipping.
• Shipping: Ambient