RACK1 Human qPCR Primer Pair (NM_006098)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
GNB2L1 (Myc-DDK-tagged)-Human guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1 (GNB2L1)
USD 300.00
Other products for "RACK1"
Specifications
Product Data | |
Gene ID | 10399 |
Forward Sequence | GCCATACCAAGGATGTGCTGAG |
Reverse Sequence | CACAAGACACCCACTCTGAGTG |
Accession No | NM_006098, NM_006098.1, NM_006098.2, NM_006098.3, NM_006098.4, BC021993, BC021993.1, BC000214, BC000366, BC010119, BC014256, BC014582, BC014788, BC017287, BC019093, BC019362, BC029996, BC032006, BC035460, NM_006098.5 |
UniProt ID | P63244 |
Synonyms | Gnb2-rs1; GNB2L1; H12.3; HLC-7; PIG21 |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.