Macrophage Inflammatory Protein 1 beta (CCL4) Human qPCR Primer Pair (NM_002984)
$142.00
2 Weeks*
| Product Data | |
| Locus ID | 6351 |
|---|---|
| Forward Sequence | GCTTCCTCGCAACTTTGTGGTAG |
| Reverse Sequence | GGTCATACACGTACTCCTGGAC |
| ACCN | NM_002984, NM_002984.2, NM_002984.3, BC107433, BC107433.1, BC027961, BC104226, BC104227, NM_002984.4 |
| UniProt ID | P13236 |
| Synonyms | ACT2; AT744.1; G-26; HC21; LAG-1; LAG1; MIP-1-beta; MIP1B; MIP1B1; SCYA2; SCYA4 |
| Components | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM. |
| Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
| Storage | Store at -20°C. |
| Stability | The primer mix is stable for one year from date of shipping. |
| Shipping | Ambient |
Write Your Own Review
| Product Manuals |
| FAQs |
Related Products
Check items to add to the cart or
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.