alpha smooth muscle Actin (ACTA2) Human qPCR Primer Pair (NM_001613)

CAT#: HP205437

qSTAR qPCR primer pairs against Homo sapiens gene ACTA2



SensiMix SYBR Master Mix

USD 142.00

2 Weeks*

Size
    • 200 reactions

Product Images

Frequently bought together (4)
ACTA2 (Myc-DDK-tagged)-Human actin, alpha 2, smooth muscle, aorta (ACTA2), transcript variant 2
    • 10 ug

USD 457.00

Special Offer: 30% off this product. Use code: Clone30


First Strand cDNA Synthesis Kit (11801-025)
    • 25 reactions

USD 165.00


First Strand cDNA Synthesis Kit (11801-100)
    • 100 reactions

USD 518.00


ACTA2 (Myc-DDK-tagged)-Human actin, alpha 2, smooth muscle, aorta (ACTA2), transcript variant 1
    • 10 ug

USD 686.00

Special Offer: 30% off this product. Use code: Clone30

Other products for "ACTA2"

Specifications

Product Data
Gene ID 59
Forward Sequence CTATGCCTCTGGACGCACAACT
Reverse Sequence CAGATCCAGACGCATGATGGCA
Accession No NM_001613, NM_001613.1, NM_001613.2, BC093052, BC093052.1, BC017554, BP248338, BP379410, BQ029841, NM_001613.4
UniProt ID P62736
Synonyms ACTSA
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage Store at -20°C.
Stability The primer mix is stable for one year from date of shipping.

{0} Product Review(s)

0 Product Review(s)

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.