TGF beta 1 (TGFB1) Human qPCR Primer Pair (NM_000660)

SKU HP200609

qSTAR qPCR primer pairs against Homo sapiens gene TGFB1

Product Data

• Locus ID: 7040
• Forward Sequence: TACCTGAACCCGTGTTGCTCTC
• Reverse Sequence: GTTGCTGAGGTATCGCCAGGAA
• ACCN: NM_000660, NM_000660.1, NM_000660.2, NM_000660.3, NM_000660.4, NM_000660.5, NM_000660.6, BC000125, BC000125.1, BC001180, BC022242, BG115704, BM692012, BP267938, BT007245, NM_000660.7
• UniProt ID: P01137
• Synonyms: CED; DPD1; IBDIMDE; LAP; TGF-beta1; TGFB; TGFbeta
• Components: 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
• Quality Control: The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
• Storage: Store at -20°C.
• Stability: The primer mix is stable for one year from date of shipping.
• Shipping: Ambient