CD42b (GP1BA) Human qPCR Primer Pair (NM_000173)
$142.00
5 Days*
Product Data | |
Locus ID | 2811 |
---|---|
Forward Sequence | ACCATCCTGGTGTCTGCCACAA |
Reverse Sequence | ACGGAGCTTTGGTGGCTGATCA |
ACCN | NM_000173, NM_000173.1, NM_000173.2, NM_000173.3, NM_000173.4, NM_000173.5, NM_000173.6, BC027955, BE463855 |
UniProt ID | P07359 |
Synonyms | BDPLT1; BDPLT3; BSS; CD42B; CD42b-alpha; DBPLT3; GP1B; GPIbA; GPIbalpha; VWDP |
Components | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM. |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Shipping | Ambient |
Write Your Own Review
Product Manuals |
FAQs |
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.