GLUD1 Human Gene Knockout Kit (CRISPR)

CAT#: KN211132

Reviews ()
Write a review

GLUD1 - human gene knockout kit via CRISPR, HDR mediated

HDR-mediated knockout kit validation

  See Other Versions

USD 1,290.00

2 Weeks

    • 1 kit

Product images


Product Data
Format 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Donor DNA GFP-puro
Symbol GLUD1
Locus ID 2746
Kit Components

KN211132G1, GLUD1 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: CGCTGTTGCTGTCCCGGGCC

KN211132G2, GLUD1 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: CCGGGCCCAGCCCAGCAACG

KN211132-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

pUC vector backbone in gray; Left arm sequence in blue; GFP-puro in green; Right arm in violet


GE100003, scramble sequence in pCas-Guide vector

Disclaimer The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_001318900, NM_001318901, NM_001318902, NM_001318904, NM_001318905, NM_001318906, NM_005271
Synonyms GDH; GDH1; GLUD
Summary This gene encodes glutamate dehydrogenase, which is a mitochondrial matrix enzyme that catalyzes the oxidative deamination of glutamate to alpha-ketoglutarate and ammonia. This enzyme has an important role in regulating amino acid-induced insulin secretion. It is allosterically activated by ADP and inhibited by GTP and ATP. Activating mutations in this gene are a common cause of congenital hyperinsulinism. Alternative splicing of this gene results in multiple transcript variants. The related glutamate dehydrogenase 2 gene on the human X-chromosome originated from this gene via retrotransposition and encodes a soluble form of glutamate dehydrogenase. Related pseudogenes have been identified on chromosomes 10, 18 and X. [provided by RefSeq, Jan 2016]


Other Versions

Other products for "GLUD1"
Frequently bought together (2)
Rabbit Polyclonal Anti-GLUD1 Antibody
    • 100 ul

USD 360.00

GLUD1 (Myc-DDK-tagged)-Human glutamate dehydrogenase 1 (GLUD1), nuclear gene encoding mitochondrial protein
    • 10 ug

USD 494.00

Customer Reviews 
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Molbio tools