DLL3 Human Gene Knockout Kit (CRISPR)

CAT#: KN200005

Reviews ()
Write a review

DLL3 - human gene knockout kit via CRISPR, HDR mediated

HDR-mediated knockout kit validation

  See Other Versions

USD 1,290.00

2 Weeks

    • 1 kit

Product images


Product Data
Format 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Donor DNA GFP-puro
Symbol DLL3
Locus ID 10683
Kit Components

KN200005G1, DLL3 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: AGAGGAGCCCGGACATCCGT

KN200005G2, DLL3 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: TGAGCGCTAGGATCACAGTC

KN200005-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

pUC vector backbone in gray; Left arm sequence in blue; GFP-puro in green; Right arm in violet


GE100003, scramble sequence in pCas-Guide vector

Disclaimer The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_016941, NM_203486
Synonyms SCDO1
Summary This gene encodes a member of the delta protein ligand family. This family functions as Notch ligands that are characterized by a DSL domain, EGF repeats, and a transmembrane domain. Mutations in this gene cause autosomal recessive spondylocostal dysostosis 1. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]


Other Versions

Other products for "DLL3"
Frequently bought together (2)
Rabbit Polyclonal DLL3 Antibody
    • 100 ug

USD 385.00

DLL3 (Myc-DDK-tagged)-Human delta-like 3 (Drosophila) (DLL3), transcript variant 2
    • 10 ug

USD 639.00

Customer Reviews 
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Molbio tools