Human Lipoprotein a (LPA) activation kit by CRISPRa

SKU GA102725

LPA CRISPRa kit - CRISPR gene activation of human lipoprotein(a)

Product Data

• Format: 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
• Target Symbol: LPA
• Locus ID: 4018
• Components:

  GA102725G1, Lipoprotein a gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGGAGGAAACAAGACTAATC

  GA102725G2, Lipoprotein a gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGTGCAATGTCAATAGATGC

  GA102725G3, Lipoprotein a gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTTATAAGACTCTATATTCA

  1 CRISPRa-Enhancer vector, SKU GE100056

  1 CRISPRa scramble vector, SKU GE100077

• OTI Disclaimer: These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
• Shipping: Ambient

Reference Data

• RefSeq: NM_005577
• Synonyms: AK38; APOA; LP
• Summary: The protein encoded by this gene is a serine proteinase that inhibits the activity of tissue-type plasminogen activator I. The encoded protein constitutes a substantial portion of lipoprotein(a) and is proteolytically cleaved, resulting in fragments that attach to atherosclerotic lesions and promote thrombogenesis. Elevated plasma levels of this protein are linked to atherosclerosis. Depending on the individual, the encoded protein contains 2-43 copies of kringle-type domains. The allele represented here contains 15 copies of the kringle-type repeats and corresponds to that found in the reference genome sequence. [provided by RefSeq, Dec 2009]