Human ATF3 activation kit by CRISPRa

SKU GA100326

ATF3 CRISPRa kit - CRISPR gene activation of human activating transcription factor 3

Product Data

• Format: 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
• Target Symbol: ATF3
• Locus ID: 467
• Components:

  GA100326G1, ATF3 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCACGGGAGAAAGCTGAGTG

  GA100326G2, ATF3 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCTCGAAGGGAAGCCTCGGT

  GA100326G3, ATF3 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTGCTTTGTGGGGCGGAGGT

  1 CRISPRa-Enhancer vector, SKU GE100056

  1 CRISPRa scramble vector, SKU GE100077

• OTI Disclaimer: These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
• Shipping: Ambient

Reference Data

• RefSeq: NM_001030287, NM_001040619, NM_001206484, NM_001206485, NM_001206486, NM_001206488, NM_001674, NM_004024
• UniProt ID: P18847
• Synonyms: FLJ41705
• Summary: This gene encodes a member of the mammalian activation transcription factor/cAMP responsive element-binding (CREB) protein family of transcription factors. This gene is induced by a variety of signals, including many of those encountered by cancer cells, and is involved in the complex process of cellular stress response. Multiple transcript variants encoding different isoforms have been found for this gene. It is possible that alternative splicing of this gene may be physiologically important in the regulation of target genes. [provided by RefSeq, Apr 2011]