Human Albumin (ALB) activation kit by CRISPRa
CAT#: GA100148
ALB CRISPRa kit - CRISPR gene activation of human albumin
Find the corresponding CRISPRi Inhibitor Kit
USD 1,657.00
2 Weeks*
Specifications
Product Data | |
Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
Symbol | ALB |
Locus ID | 213 |
Kit Components | GA100148G1, Albumin gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCTATAGGTAAAAGCACACT GA100148G2, Albumin gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: ATTAGCAATAGATGCAATTT GA100148G3, Albumin gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCTAAGCAAAGTATTTAGTT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc. |
Reference Data | |
RefSeq | NM_000477, N53869 |
UniProt ID | P02768 |
Synonyms | HSA; PRO0883; PRO0903; PRO1341 |
Summary | This gene encodes the most abundant protein in human blood. This protein functions in the regulation of blood plasma colloid osmotic pressure and acts as a carrier protein for a wide range of endogenous molecules including hormones, fatty acids, and metabolites, as well as exogenous drugs. Additionally, this protein exhibits an esterase-like activity with broad substrate specificity. The encoded preproprotein is proteolytically processed to generate the mature protein. A peptide derived from this protein, EPI-X4, is an endogenous inhibitor of the CXCR4 chemokine receptor. [provided by RefSeq, Jul 2016] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN405943 | ALB - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
USD 1,657.00 |
{0} Product Review(s)
Be the first one to submit a review