SMARCA2 (NM_001289400) Human Untagged Clone

SKU
SC335016
SMARCA2 (untagged) - Human SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 (SMARCA2), transcript variant 7
$330.00
2 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol SMARCA2
Synonyms BAF190; BIS; BRM; hBRM; hSNF2a; NCBRS; SNF2; SNF2L2; SNF2LA; Sth1p; SWI2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_001289400, the custom clone sequence may differ by one or more nucleotides


ATGCTGATGAAGAGACTAGCAGCTCGCTGCTTTGCTGGCTTGTTAATTTTATCCCCACTAACTGTGATTT
CTGATAGCCGGCCTGCTGATAGTGGTAAGGCCATCGAAGACGGCAATTTGGAGGAAATGGAAGAGGAAGT
ACGGCTTAAGAAGCGAAAAAGACGAAGAAATGTGGATAAAGATCCTGCAAAAGAAGATGTGGAAAAAGCT
AAGAAGAGAAGAGGCCGCCCTCCCGCTGAGAAACTGTCACCAAATCCCCCCAAACTGACAAAGCAGATGA
ACGCTATCATCGATACTGTGATAAACTACAAAGATAGTTCAGGGCGACAGCTCAGTGAAGTCTTCATTCA
GTTACCTTCAAGGAAAGAATTACCAGAATACTATGAATTAATTAGGAAGCCAGTGGATTTCAAAAAAATA
AAGGAAAGGATTCGTAATCATAAGTACCGGAGCCTAGGCGACCTGGAGAAGGATGTCATGCTTCTCTGTC
ACAACGCTCAGACGTTCAACCTGGAGGGATCCCAGATCTATGAAGACTCCATCGTCTTACAGTCAGTGTT
TAAGAGTGCCCGGCAGAAAATTGCCAAAGAGGAAGAGAGTGAGGATGAAAGCAATGAAGAGGAGGAAGAG
GAAGATGAAGAAGAGTCAGAGTCCGAGGCAAAATCAGTCAAGGTGAAAATTAAGCTCAATAAAAAAGATG
ACAAAGGCCGGGACAAAGGGAAAGGCAAGAAAAGGCCAAATCGAGGAAAAGCCAAACCTGTAGTGAGCGA
TTTTGACAGCGATGAGGAGCAGGATGAACGTGAACAGTCAGAAGGAAGTGGGACGGATGATGAGTGA


Restriction Sites SgfI-MluI
ACCN NM_001289400
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001289400.1, NP_001276329.1
RefSeq Size 2254 bp
RefSeq ORF 837 bp
Locus ID 6595
Cytogenetics 9p24.3
Protein Families Druggable Genome
Summary The protein encoded by this gene is a member of the SWI/SNF family of proteins and is highly similar to the brahma protein of Drosophila. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. Alternatively spliced transcript variants encoding different isoforms have been found for this gene, which contains a trinucleotide repeat (CAG) length polymorphism. [provided by RefSeq, Jan 2014]
Transcript Variant: This variant (7) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate downstream start codon, compared to variant 1. The encoded protein (isoform f) has a shorter and distinct N-terminus, compared to isoform a.
Write Your Own Review
You're reviewing:SMARCA2 (NM_001289400) Human Untagged Clone
Your Rating
SKU Description Size Price
RC237122 SMARCA2 (myc-DDK-tagged) - Human SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 (SMARCA2), transcript variant 7 10 ug
$330.00
RG237122 SMARCA2 (tGFP-tagged) - Human SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 (SMARCA2), transcript variant 7 10 ug
$530.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.