Allergin 1 (MILR1) (NM_001291316) Human Untagged Clone
SKU
SC334810
MILR1 (untagged) - Human mast cell immunoglobulin-like receptor 1 (MILR1), transcript variant S1
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | Allergin 1 |
Synonyms | Allergin-1; C17orf60; MCA-32; MCA32 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>NCBI ORF sequence for NM_001291316, the custom clone sequence may differ by one or more nucleotides
ATGTGGAGCCATTTGAACAGGCTCCTCTTCTGGAGCATATTTTCTTCTGTCACTTGTAGAAAAGCTGTAT TGGATTGTGAGGCAATGAAAACAAATGAATTCCCTTCTCCATGTTTGGACTCAAAGACTAAGGTGGTTAT GAAGGGTCAAAATGTATCTATGTTTTGTTCCCATAAGAACAAATCACTGCAGATCACCTATTCATTGTTT CGACGTAAGACACACCTGGGAACCCAGGATGGAAAAGGTGAACCTGCGATTTTTAACCTAAGCATCACAG AAGCCCATGAATCAGGCCCCTACAAATGCAAAGCCCAAGTTACCAGCTGTTCAAAATACAGTCGTGACTT CAGCTTCACGATTGTCGGCGGAGACAGCTGTCCTTTCTGTCTGAAGCTACTACTTCCAGGGTTATTACTG TTGCTGGTGGTGATAATCCTAATTCTGGCTTTTTGGGTACTGCCCAAATACAAAACAAGAAAAGCTATGA GAAATAATGTGCCCAGGGACCGTGGAGACACAGCCATGGAAGTTGGAATCTATGCAAATATCCTTGAAAA ACAAGCAAAGGAGGAATCTGTGCCAGAAGTGGGATCCAGGCCGTGTGTTTCCACAGCCCAAGATGAGGCC AAACACTCCCAGGAGCTACAGTATGCCACCCCCGTGTTCCAGGAGGTGGCACCAAGAGAGCAAGAAGCCT GTGATTCTTATAAATCTGGATATGTCTATTCTGAACTCAACTTCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001291316 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_001291316.1, NP_001278245.1 |
RefSeq Size | 1176 bp |
RefSeq ORF | 747 bp |
Locus ID | 284021 |
UniProt ID | Q7Z6M3 |
Cytogenetics | 17q23.3 |
Protein Families | Druggable Genome, Transmembrane |
Summary | Immunoglobulin-like receptor which plays an inhibitory role in degranulation of mast cells. Negatively regulates IgE-mediated mast cell activation and suppresses the type I immediate hypersensitivity reaction (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (S1) lacks an alternate in-frame exon in the central coding region, compared to variant L, resulting in an isoform (Allergin-1S1, also known as short form 1) that is shorter than isoform Allergin-1L. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.