G2A (GPR132) (NM_001278696) Human Untagged Clone

SKU
SC334344
GPR132 (untagged) - Human G protein-coupled receptor 132 (GPR132), transcript variant 4
$330.00
2 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol G2A
Synonyms G2A
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_001278696, the custom clone sequence may differ by one or more nucleotides


ATGCTGCAGATGGACAGCAGGATTGCCGGGTACTACTACGCCAGGTTCACCGTTGGCTTTGCCATCCCTC
TCTCCATCATCGCCTTCACCAACCACCGGATTTTCAGGAGCATCAAGCAGAGCATGGGCTTAAGCGCTGC
CCAGAAGGCCAAGGTGAAGCACTCGGCCATCGCGGTGGTTGTCATCTTCCTAGTCTGCTTCGCCCCGTAC
CACCTGGTTCTCCTCGTCAAAGCCGCTGCCTTTTCCTACTACAGAGGAGACAGGAACGCCATGTGCGGCT
TGGAGGAAAGGCTGTACACAGCCTCTGTGGTGTTTCTGTGCCTGTCCACGGTGAACGGCGTGGCTGACCC
CATTATCTACGTGCTGGCCACGGACCATTCCCGCCAAGAAGTGTCCAGAATCCATAAGGGGTGGAAAGAG
TGGTCCATGAAGACAGACGTCACCAGGCTCACCCACAGCAGGGACACCGAGGAGCTGCAGTCGCCCGTGG
CCCTTGCAGACCACTACACCTTCTCCAGGCCCGTGCACCCACCAGGGTCACCATGCCCTGCAAAGAGGCT
GATTGAGGAGTCCTGCTGA


Restriction Sites SgfI-MluI
ACCN NM_001278696
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001278696.1, NP_001265625.1
RefSeq Size 2894 bp
RefSeq ORF 579 bp
Locus ID 29933
UniProt ID Q9UNW8
Cytogenetics 14q32.33
Protein Families Druggable Genome, GPCR, Transmembrane
Summary This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor (GPCR) superfamily. The receptors are seven-pass transmembrane proteins that respond to extracellular cues and activate intracellular signal transduction pathways. This protein was reported to be a receptor for lysophosphatidylcholine action, but PubMedID: 15653487 retracts this finding and instead suggests this protein to be an effector of lysophosphatidylcholine action. This protein may have proton-sensing activity and may be a receptor for oxidized free fatty acids. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Transcript Variant: This variant (4) differs in the 5' UTR and 5' coding region and uses a downstream, in-frame start codon, compared to variant 1. The encoded isoform (3) has a shorter N-terminus compared to isoform 1.
Write Your Own Review
You're reviewing:G2A (GPR132) (NM_001278696) Human Untagged Clone
Your Rating
SKU Description Size Price
RC236450 GPR132 (myc-DDK-tagged) - Human G protein-coupled receptor 132 (GPR132), transcript variant 4 10 ug
$330.00
RG236450 GPR132 (tGFP-tagged) - Human G protein-coupled receptor 132 (GPR132), transcript variant 4 10 ug
$530.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.