Neuritin (NRN1) (NM_001278710) Human Untagged Clone

SKU SC333888

NRN1 (untagged) - Human neuritin 1 (NRN1), transcript variant 2

Product Data

• Type: Human Untagged Clone
• Target Symbol: Neuritin
• Synonyms: dJ380B8.2; NRN
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC333888 representing NM_001278710.; Blue=Insert sequence Red=Cloning site Green=Tag(s); ; ATGGGACTTAAGTTGAACGGCAGATATATTTCACTGATCCTCGCGGTGCAAATAGCGTATCTGGTGCAG; GCCGTGAGAGCAGCGGGCAAGTGCGATGCGGTCTTCAAGGGCTTTTCGGACTGTTTGCTCAAGCTGGGC; GACAGCATGGCCAACTACCCGCAGGGCCTGGACGACAAGACGAACATCAAGACCGTGTGCACATACTGG; GAGGATTTCCACAGCTGCACGGTCACAGCCCTTACGGATTGCCAGGAAGGGGCGAAAGATATGTGGGAT; AAACTGAGAAAAGAATCCAAAAACCTCAACATCCAAGGCAGCTTATTCGAACTCTGCGGCAGCGGCAAC; GGGGCGGCGGGGTCCCTGCTCCCGGCGTTCCCGGTGCTCCTGGTGTCTCTCTCGGCAGCTTTAGCGACC; TGGCTTTCCTTCTGA;
• Restriction Sites: SgfI-MluI
• ACCN: NM_001278710
• Insert Size: 429 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_001278710.1
• RefSeq Size: 1574 bp
• RefSeq ORF: 429 bp
• Locus ID: 51299
• UniProt ID: Q9NPD7
• Cytogenetics: 6p25.1
• MW: 15.3 kDa
• Summary: This gene encodes a member of the neuritin family, and is expressed in postmitotic-differentiating neurons of the developmental nervous system and neuronal structures associated with plasticity in the adult. The expression of this gene can be induced by neural activity and neurotrophins. The encoded protein contains a consensus cleavage signal found in glycosylphoshatidylinositol (GPI)-anchored proteins. The encoded protein promotes neurite outgrowth and arborization, suggesting its role in promoting neuritogenesis. Overexpression of the encoded protein may be associated with astrocytoma progression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]; Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1. Both variants 1 and 2 encode the same isoform (1).