Cylicin 1 (CYLC1) (NM_001271680) Human Untagged Clone

SKU SC333344

CYLC1 (untagged) - Human cylicin, basic protein of sperm head cytoskeleton 1 (CYLC1), transcript variant 2

Product Data

• Type: Human Untagged Clone
• Target Symbol: Cylicin 1
• Synonyms: CYCL1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC333344 representing NM_001271680.; Blue=Insert sequence Red=Cloning site Green=Tag(s); ; GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG; GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC; ATGTCTCTTCCAAGGCTAAAAGTAAACATCAGAACATATGATAATTCCATTCCAATCAGTGAATCAAGC; AGAAAATCATGGAATCAAAAACACTTTGCTTTGACATTTCCCAAACCACTCCAGAGAGGTACAAATGAT; AAATCAAGACCTTTGAAATCACAAATAACAGTTACTCCTGAAGCACCGTGGATTCATAAGCTGCTTTAA; ; ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT; TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC;
• Restriction Sites: SgfI-MluI
• ACCN: NM_001271680
• Insert Size: 207 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_001271680.1
• RefSeq Size: 394 bp
• RefSeq ORF: 207 bp
• Locus ID: 1538
• Cytogenetics: Xq21.1
• MW: 7.9 kDa
• Summary: This gene encodes a sperm head cytoskeletal protein. The encoded protein is associated with the calyx of spermatozoa and spermatids. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]; Transcript Variant: This variant (2) uses an alternate in-frame splice site and lacks an alternate in-frame exon compared to variant 1. It encodes a shorter protein (isoform 2) compared to isoform 1.