Dysbindin (DTNBP1) (NM_001271669) Human Untagged Clone

SKU
SC333082
DTNBP1 (untagged) - Homo sapiens dystrobrevin binding protein 1 (DTNBP1), transcript variant 6
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Dysbindin
Synonyms BLOC1S8; DBND; HPS7; My031; SDY
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>SC333082 representing NM_001271669.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCTGGAGACCCTTCGCGAGCGGCTGCTGAGCGTGCAGCAGGATTTCACCTCCGGGTATGAGGATACA
TGGGCTGCACTTCACAGAAGAGCCAAAGACTGTGCAAGTGCTGGAGAGCTGGTGGATAGCGAGGTGGTC
ATGCTTTCTGCGCACTGGGAGAAGAAAAAGACAAGCCTCGTGGAGCTGCAAGAGCAGCTCCAGCAGCTC
CCAGCTTTAATCGCAGACTTAGAATCCATGACAGCAAATCTGACTCATTTAGAGGCGAGTTTTGAGGAG
GTAGAGAACAACCTGCTGCATCTGGAAGACTTATGTGGGCAGTGTGAATTAGAAAGATGCAAACATATG
CAGTCCCAGCAACTGGAGAATTACAAGAAAAATAAGAGGAAGGAACTTGAAACCTTCAAAGCTGAACTA
GATGCAGAGCACGCCCAGAAGGTCCTGGAAATGGAGCACACCCAGCAAATGAAGCTGAAGGAGCGGCAG
AAGTTTTTTGAGGAAGCCTTCCAGCAGGACATGGAGCAGTACCTGTCCACTGGCTACCTGCAGATTGCA
GAGCGGCGAGAGCCCATAGGCAGCATGTCATCCATGGAAGTGAACGTGGACATGCTGGAGCAGATGGAC
CTGATGGACATATCGGACCAGGAGGCCCTGGACGTCTTCCTGAACTCTGGAGGAGAAGAGAACACTGTG
CTGTCCCCCGCCTTAGGGCCTGAATCCAGTACCTGTCAGAATGAGATTACCCTCCAGGTTCCAAATCCC
TCAGAATTAAGAGCCAAGCCACCTTCTTCTTCCTCCACCTGCACCGACTCGGCCACCCGGGACATCAGT
GAGGGTGGGGAGTCCCCCGTTGTTCAGTCCGATGAGGAGGAAGTTCAGGTGGACACTGCCCTGGCCACA
TCACACACTGACAGAGAGGCCACTCCGGATGGTGGTGAGGACAGCGACTCTTAA

Restriction Sites SgfI-MluI
ACCN NM_001271669
Insert Size 951 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001271669.1
RefSeq Size 1319 bp
RefSeq ORF 951 bp
Locus ID 84062
UniProt ID Q96EV8
Cytogenetics 6p22.3
Protein Families Druggable Genome
MW 35.6 kDa
Summary This gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. A similar protein in mouse is a component of a protein complex termed biogenesis of lysosome-related organelles complex 1 (BLOC-1), and binds to alpha- and beta-dystrobrevins, which are components of the dystrophin-associated protein complex (DPC). Mutations in this gene are associated with Hermansky-Pudlak syndrome type 7. This gene may also be associated with schizophrenia. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (6) omits two in-frame coding exons compared to variant 1. The resulting protein isoform (e) is shorter than isoform a.
Write Your Own Review
You're reviewing:Dysbindin (DTNBP1) (NM_001271669) Human Untagged Clone
Your Rating
SKU Description Size Price
RC233741 DTNBP1 (Myc-DDK tagged) - Homo sapiens dystrobrevin binding protein 1 (DTNBP1), transcript variant 6 10 ug
$330.00
RG233741 DTNBP1 (tGFP-tagged) - Homo sapiens dystrobrevin binding protein 1 (DTNBP1), transcript variant 6 10 ug
$530.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.