CREB3L2 (NM_001253775) Human Untagged Clone
SKU
SC332224
CREB3L2 (untagged) - Homo sapiens cAMP responsive element binding protein 3-like 2 (CREB3L2), transcript variant 2
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | CREB3L2 |
Synonyms | BBF2H7 |
Vector | pCMV6-Entry |
Sequence Data |
Fully Sequenced ORF
>SC332224 representing NM_001253775.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGAGGTGCTGGAGAGCGGGGAGCAGGGCGTGCTGCAGTGGGACCGCAAGCTGAGCGAGCTGTCAGAG CCCGGGGACGGCGAGGCCCTCATGTACCACACGCACTTCTCAGAACTTCTGGATGAGTTTTCCCAGAAC GTCTTGGGTCAGCTCCTGAATGATCCTTTCCTCTCAGAGAAGAGTGTGTCAATGGAGGTGGAACCTTCC CCGACGTCCCCGGCGCCTCTCATCCAGGCTGAGCACAGCTACTCCCTGTGCGAGGAGCCTCGGGCCCAG TCGCCCTTCACCCACATTACCACCAGTGACAGCTTCAATGACGATGAGGTGGAAAGTGAGAAATGGTAC CTGTCTACAGACTTCCCTTCAACATCCATCAAGACAGAGCCAGTTACAGACGAACCACCCCCAGGACTC GTTCCGTCTGTCACTCTGACCATCACAGCCATCTCCACCCCGTTGGAAAAGGAGGAACCTCCTCTGGAA ATGAACACTGGGGTTGATTCCTCGTGCCAGACCATTATTCCTAAAATTAAGCTGGAGCCTCATGAAGTG GATCAGTTTCTAAACTTCTCTCCTAAAGAAGGTCTGTCTGCCCTCCCTGTGTCCCTTTGGGTTATGGAT ATGGTCTCTGGGTCTACAGAGAGGGAATATGGCGAGAGAGCTGGGATGAGTTTGTACCACAGATGTTGT AGCTGGCTTTATGAAATAGCTCTGTTCTTAAAAAATAAAAATTTTGCTTCCAAATAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001253775 |
Insert Size | 747 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_001253775.1 |
RefSeq Size | 1175 bp |
RefSeq ORF | 747 bp |
Locus ID | 64764 |
UniProt ID | Q70SY1 |
Cytogenetics | 7q33 |
Protein Families | Transcription Factors |
Protein Pathways | Huntington's disease, Melanogenesis, Prostate cancer |
MW | 27.7 kDa |
Summary | This gene encodes a member of the oasis bZIP transcription factor family. Members of this family can dimerize but form homodimers only. The encoded protein is a transcriptional activator. Translocations between this gene on chromosome 7 and the gene fused in sarcoma on chromosome 16 can be found in some tumors. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011] Transcript Variant: This variant (2) differs in the 3' coding region and UTR compared to variant 1. The resulting protein (isoform 2) is shorter and has a distinct C-terminus compared to isoform 1. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC233544 | CREB3L2 (Myc-DDK tagged) - Homo sapiens cAMP responsive element binding protein 3-like 2 (CREB3L2), transcript variant 2 | 10 ug |
$330.00
|
|
RG233544 | CREB3L2 (tGFP-tagged) - Homo sapiens cAMP responsive element binding protein 3-like 2 (CREB3L2), transcript variant 2 | 10 ug |
$530.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.