Osteopontin (SPP1) (NM_001251830) Human Untagged Clone

SKU
SC332134
SPP1 (untagged) - Homo sapiens secreted phosphoprotein 1 (SPP1), transcript variant 5
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Osteopontin
Synonyms BNSP; BSPI; ETA-1; OPN
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>SC332134 representing NM_001251830.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGGCATTGTCCCCAGAAGCTTGGACAAAAAGGCACACAGAGTTCAATTCCAGTTGAACAGAATAAAG
GCCAAAATAGAGCTGCCTTGGGGGTCACTGCAATTAGACTGCTTAATGAAGACATTAAAAGAACTTTAC
AACAAATACCCAGATGCTGTGGCCACATGGCTAAACCCTGACCCATCTCAGAAGCAGAATCTCCTAGCC
CCACAGAATGCTGTGTCCTCTGAAGAAACCAATGACTTTAAACAAGAGACCCTTCCAAGTAAGTCCAAC
GAAAGCCATGACCACATGGATGATATGGATGATGAAGATGATGATGACCATGTGGACAGCCAGGACTCC
ATTGACTCGAACGACTCTGATGATGTAGATGACACTGATGATTCTCACCAGTCTGATGAGTCTCACCAT
TCTGATGAATCTGATGAACTGGTCACTGATTTTCCCACGGACCTGCCAGCAACCGAAGTTTTCACTCCA
GTTGTCCCCACAGTAGACACATATGATGGCCGAGGTGATAGTGTGGTTTATGGACTGAGGTCAAAATCT
AAGAAGTTTCGCAGACCTGACATCCAGTACCCTGATGCTACAGACGAGGACATCACCTCACACATGGAA
AGCGAGGAGTTGAATGGTGCATACAAGGCCATCCCCGTTGCCCAGGACCTGAACGCGCCTTCTGATTGG
GACAGCCGTGGGAAGGACAGTTATGAAACGAGTCAGCTGGATGACCAGAGTGCTGAAACCCACAGCCAC
AAGCAGTCCAGATTATATAAGCGGAAAGCCAATGATGAGAGCAATGAGCATTCCGATGTGATTGATAGT
CAGGAACTTTCCAAAGTCAGCCGTGAATTCCACAGCCATGAATTTCACAGCCATGAAGATATGCTGGTT
GTAGACCCCAAAAGTAAGGAAGAAGATAAACACCTGAAATTTCGTATTTCTCATGAATTAGATAGTGCA
TCTTCTGAGGTCAATTAA

Restriction Sites SgfI-MluI
ACCN NM_001251830
Insert Size 984 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001251830.1
RefSeq Size 1823 bp
RefSeq ORF 984 bp
Locus ID 6696
UniProt ID P10451
Cytogenetics 4q22.1
Protein Families Druggable Genome, Secreted Protein
Protein Pathways ECM-receptor interaction, Focal adhesion, Toll-like receptor signaling pathway
MW 37.2 kDa
Summary The protein encoded by this gene is involved in the attachment of osteoclasts to the mineralized bone matrix. The encoded protein is secreted and binds hydroxyapatite with high affinity. The osteoclast vitronectin receptor is found in the cell membrane and may be involved in the binding to this protein. This protein is also a cytokine that upregulates expression of interferon-gamma and interleukin-12. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Transcript Variant: This variant (5) represents the longest transcript and encodes the longest isoform (5). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:Osteopontin (SPP1) (NM_001251830) Human Untagged Clone
Your Rating
SKU Description Size Price
RC233777 SPP1 (Myc-DDK tagged) - Homo sapiens secreted phosphoprotein 1 (SPP1), transcript variant 5 10 ug
$330.00
RG233777 SPP1 (tGFP-tagged) - Homo sapiens secreted phosphoprotein 1 (SPP1), transcript variant 5 10 ug
$530.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.