KIR3DL2 (NM_001242867) Human Untagged Clone

SKU
SC331908
KIR3DL2 (untagged) - Homo sapiens killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 2 (KIR3DL2), transcript variant 2
$503.00
5 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol KIR3DL2
Synonyms 3DL2; CD158K; KIR-3DL2; NKAT-4; NKAT4; NKAT4B; p140
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>SC331908 representing NM_001242867.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTCGCTCACGGTCGTCAGCATGGCGTGCGTTGGGTTCTTCTTGCTGCAGGGGGCCTGGCCACTCATG
GGTGGTCAGGACAAACCCTTCCTGTCTGCCCGGCCCAGCACTGTGGTGCCTCGAGGAGGACACGTGGCT
CTTCAGTGTCACTATCGTCGTGGGTTTAACAATTTCATGCTGTACAAAGAAGACAGAAGCCACGTTCCC
ATCTTCCACGGCAGAATATTCCAGGAGAGCTTCATCATGGGCCCTGTGACCCCAGCACATGCAGGGACC
TACAGATGTCGGGGTTCACGCCCACACTCCCTCACTGGGTGGTCGGCACCCAGCAACCCCCTGGTGATC
ATGGTCACAGGAAACCACAGAAAACCTTCCCTCCTGGCCCACCCAGGGCCCCTGCTGAAATCAGGAGAG
ACAGTCATCCTGCAATGTTGGTCAGATGTCATGTTTGAGCACTTCTTTCTGCACAGAGAGGGGATCTCT
GAGGACCCCTCACGCCTCGTTGGACAGATCCATGATGGGGTCTCCAAGGCCAACTTCTCCATCGGTCCC
TTGATGCCTGTCCTTGCAGGAACCTACAGATGTTATGGTTCTGTTCCTCACTCCCCCTATCAGTTGTCA
GCTCCCAGTGACCCCCTGGACATCGTGATCACAGGTCTATATGAGAAACCTTCTCTCTCAGCCCAGCCG
GGCCCCACGGTTCAGGCAGGAGAGAACGTGACCTTGTCCTGTAGCTCCTGGAGCTCCTATGACATCTAC
CATCTGTCCAGGGAAGGGGAGGCCCATGAACGTAGGCTCCGTGCAGTGCCCAAGGTCAACAGAACATTC
CAGGCAGACTTTCCTCTGGGCCCTGCCACCCACGGAGGGACCTACAGATGCTTCGGCTCTTTCCGTGCC
CTGCCCTGCGTGTGGTCAAACTCAAGTGACCCACTGCTTGTTTCTGTCACAGGTATCTGCAGACACCTG
CATGTTCTGATTGGGACCTCAGTGGTCATCTTCCTCTTCATCCTCCTCCTCTTCTTTCTCCTTTATCGC
TGGTGCTCCAACAAAAAGAATGCTGCTGTAATGGACCAAGAGCCTGCGGGGGACAGAACAGTGAATAGG
CAGGACTCTGATGAACAAGACCCTCAGGAGGTGACGTACGCACAGTTGGATCACTGCGTTTTCATACAG
AGAAAAATCAGTCGCCCTTCTCAGAGGCCCAAGACACCCCTAACAGATACCAGCGTGTACACGGAACTT
CCAAATGCTGAGCCCAGATCCAAAGTTGTCTCCTGCCCACGAGCACCACAGTCAGGTCTTGAGGGGGTT
TTCTAG

Restriction Sites SgfI-MluI
ACCN NM_001242867
Insert Size 1317 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001242867.1
RefSeq Size 1834 bp
RefSeq ORF 1317 bp
Locus ID 3812
UniProt ID P43630
Cytogenetics 19q13.42
Protein Families Transmembrane
Protein Pathways Antigen processing and presentation, Graft-versus-host disease, Natural killer cell mediated cytotoxicity
MW 48.5 kDa
Summary Killer cell immunoglobulin-like receptors (KIRs) are transmembrane glycoproteins expressed by natural killer cells and subsets of T cells. The KIR genes are polymorphic and highly homologous and they are found in a cluster on chromosome 19q13.4 within the 1 Mb leukocyte receptor complex (LRC). The gene content of the KIR gene cluster varies among haplotypes, although several "framework" genes are found in all haplotypes (KIR3DL3, KIR3DP1, KIR3DL4, KIR3DL2). The KIR proteins are classified by the number of extracellular immunoglobulin domains (2D or 3D) and by whether they have a long (L) or short (S) cytoplasmic domain. KIR proteins with the long cytoplasmic domain transduce inhibitory signals upon ligand binding via an immune tyrosine-based inhibitory motif (ITIM), while KIR proteins with the short cytoplasmic domain lack the ITIM motif and instead associate with the TYRO protein tyrosine kinase binding protein to transduce activating signals. The ligands for several KIR proteins are subsets of HLA class I molecules; thus, KIR proteins are thought to play an important role in regulation of the immune response. This gene is one of the "framework" loci that is present on all haplotypes. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jun 2011]
Transcript Variant: This variant (2) lacks an exon in the coding region but maintains the reading frame, compared to variant 1. The encoded isoform (2) is shorter than isoform 1.
Write Your Own Review
You're reviewing:KIR3DL2 (NM_001242867) Human Untagged Clone
Your Rating
SKU Description Size Price
RC234094 KIR3DL2 (Myc-DDK tagged) - Homo sapiens killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 2 (KIR3DL2), transcript variant 2 10 ug
$503.00
RG234094 KIR3DL2 (tGFP-tagged) - Homo sapiens killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 2 (KIR3DL2), transcript variant 2 10 ug
$703.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.