CAMTA1 (NM_001242701) Human Untagged Clone
SKU
SC330004
CAMTA1 (untagged) - Homo sapiens calmodulin binding transcription activator 1 (CAMTA1), transcript variant 3
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | CAMTA1 |
Synonyms | CANPMR |
Vector | pCMV6-Entry |
Sequence Data |
Fully Sequenced ORF
>SC330004 representing NM_001242701.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGTGGCGCGCGGAGGGGAAATGGCTGCCGAAAACAAGCCGGAAGAGCGTTTCCCAAAGTGTATTCTGC GGAACTAGCACCTACTGTGTTCTCAACACCGTGCCACCTATAGAAGATGATCATGGGAACAGCAATAGT AGTCATGTAAAAATCTTTTTACCGAAAAAGCTGCTTGAATGTCTGCCGAAATGTTCAAGTTTACCAAAA GAGAGGCACCGCTGGAACACTAATGAGGCTCTCACCACACACTTGTTCATGGGCGCAGCAAAGAAGAGG GATCCACAGAGCTGGAGCCATGAGGGCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001242701 |
Insert Size | 306 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_001242701.1 |
RefSeq Size | 997 bp |
RefSeq ORF | 306 bp |
Locus ID | 23261 |
UniProt ID | Q9Y6Y1 |
Cytogenetics | 1p36.31-p36.23 |
Protein Families | Transcription Factors |
MW | 11.5 kDa |
Summary | The protein encoded by this gene contains a CG1 DNA-binding domain, a transcription factor immunoglobulin domain, ankyrin repeats, and calmodulin-binding IQ motifs. The encoded protein is thought to be a transcription factor and may be a tumor suppressor. However, a translocation event is sometimes observed between this gene and the WWTR1 gene, with the resulting WWTR1-CAMTA1 oncoprotein leading to epithelioid hemangioendothelioma, a malignant vascular cancer. [provided by RefSeq, Mar 2017] Transcript Variant: This variant (3) uses an alternate, 3' terminal exon compared to variant 1. This results in a shorter protein (isoform c, also known as 3) that lacks the ankyrin repeats and calmodulin-binding motifs, compared to isoform a. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.