STEAP4 (NM_001205316) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | STEAP4 |
Synonyms | SchLAH; STAMP2; TIARP; TNFAIP9 |
Vector | pCMV6-Entry |
Sequence Data |
Fully Sequenced ORF
>SC329805 representing NM_001205316.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGAGAAAACTTGTATAGATGCACTTCCTCTTACTATGAATTCTTCAGAAAAGCAAGAGACTGTATGT ATTTTTGGAACTGGTGATTTTGGAAGATCACTGGGATTGAAAATGCTCCAGTGTGGTTATTCTGTTGTT TTTGGAAGTCGAAACCCCCAGAAGACCACCCTACTGCCCAGTGGTGCAGAAGTCTTGAGCTATTCAGAA GCAGCCAAGAAGTCTGGCATCATAATCATAGCAATCCACAGAGAGCATTATGATTTTCTCACAGAATTA ACTGAGGTTCTCAATGGAAAAATATTGGTAGACATCAGCAACAACCTCAAAATCAATCAATATCCAGAA TCTAATGCAGAGTACCTTGCTCATTTGGTGCCAGGAGCCCACGTGGTAAAAGCATTTAACACCATCTCA GCCTGGGCTCTCCAGTCAGGAGCACTGGATGCAAGTCGGCAGGCAATACTCAAGAAGGAGAATCCATTT AGCACCTCCTCAGCCTGGCTCAGTGATTCATATGTGGCTTTGGGAATACTTGGGTTTTTTCTGTTTGTA CTCTTGGGAATCACTTCTTTGCCATCTGTTAGCAATGCAGTCAACTGGAGAGAGTTCCGATTTGTCCAG TCCAAACTGGGTTATTTGACCCTGATCTTGTGTACAGCCCACACCCTGGTGTACGGTGGGAAGAGATTC CTCAGCCCTTCAAATCTCAGATGGTATCTTCCTGCAGCCTACGTGTTAGGGCTTATCATTCCTTGCACT GTGCTGGTGATCAAGTTTGTCCTAATCATGCCATGTGTAGACAACACCCTTACAAGGATCCGCCAGGGC TGGGAAAGGAACTCAAAACACTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001205316 |
Insert Size | 852 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_001205316.1 |
RefSeq Size | 3960 bp |
RefSeq ORF | 852 bp |
Locus ID | 79689 |
UniProt ID | Q687X5 |
Cytogenetics | 7q21.12 |
Protein Families | Druggable Genome, Transmembrane |
MW | 31.3 kDa |
Summary | The protein encoded by this gene belongs to the STEAP (six transmembrane epithelial antigen of prostate) family, and resides in the golgi apparatus. It functions as a metalloreductase that has the ability to reduce both Fe(3+) to Fe(2+) and Cu(2+) to Cu(1+), using NAD(+) as acceptor. Studies in mice and human suggest that this gene maybe involved in adipocyte development and metabolism, and may contribute to the normal biology of the prostate cell, as well as prostate cancer progression. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2011] Transcript Variant: This variant (3) lacks an in-frame coding exon compared to variant 1, resulting in a shorter isoform (2) missing an internal protein segment compared to isoform 1. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.