STEAP4 (NM_001205316) Human Untagged Clone

SKU
SC329805
STEAP4 (untagged) - Homo sapiens STEAP family member 4 (STEAP4), transcript variant 3
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol STEAP4
Synonyms SchLAH; STAMP2; TIARP; TNFAIP9
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>SC329805 representing NM_001205316.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGAGAAAACTTGTATAGATGCACTTCCTCTTACTATGAATTCTTCAGAAAAGCAAGAGACTGTATGT
ATTTTTGGAACTGGTGATTTTGGAAGATCACTGGGATTGAAAATGCTCCAGTGTGGTTATTCTGTTGTT
TTTGGAAGTCGAAACCCCCAGAAGACCACCCTACTGCCCAGTGGTGCAGAAGTCTTGAGCTATTCAGAA
GCAGCCAAGAAGTCTGGCATCATAATCATAGCAATCCACAGAGAGCATTATGATTTTCTCACAGAATTA
ACTGAGGTTCTCAATGGAAAAATATTGGTAGACATCAGCAACAACCTCAAAATCAATCAATATCCAGAA
TCTAATGCAGAGTACCTTGCTCATTTGGTGCCAGGAGCCCACGTGGTAAAAGCATTTAACACCATCTCA
GCCTGGGCTCTCCAGTCAGGAGCACTGGATGCAAGTCGGCAGGCAATACTCAAGAAGGAGAATCCATTT
AGCACCTCCTCAGCCTGGCTCAGTGATTCATATGTGGCTTTGGGAATACTTGGGTTTTTTCTGTTTGTA
CTCTTGGGAATCACTTCTTTGCCATCTGTTAGCAATGCAGTCAACTGGAGAGAGTTCCGATTTGTCCAG
TCCAAACTGGGTTATTTGACCCTGATCTTGTGTACAGCCCACACCCTGGTGTACGGTGGGAAGAGATTC
CTCAGCCCTTCAAATCTCAGATGGTATCTTCCTGCAGCCTACGTGTTAGGGCTTATCATTCCTTGCACT
GTGCTGGTGATCAAGTTTGTCCTAATCATGCCATGTGTAGACAACACCCTTACAAGGATCCGCCAGGGC
TGGGAAAGGAACTCAAAACACTAG

Restriction Sites SgfI-MluI
ACCN NM_001205316
Insert Size 852 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001205316.1
RefSeq Size 3960 bp
RefSeq ORF 852 bp
Locus ID 79689
UniProt ID Q687X5
Cytogenetics 7q21.12
Protein Families Druggable Genome, Transmembrane
MW 31.3 kDa
Summary The protein encoded by this gene belongs to the STEAP (six transmembrane epithelial antigen of prostate) family, and resides in the golgi apparatus. It functions as a metalloreductase that has the ability to reduce both Fe(3+) to Fe(2+) and Cu(2+) to Cu(1+), using NAD(+) as acceptor. Studies in mice and human suggest that this gene maybe involved in adipocyte development and metabolism, and may contribute to the normal biology of the prostate cell, as well as prostate cancer progression. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2011]
Transcript Variant: This variant (3) lacks an in-frame coding exon compared to variant 1, resulting in a shorter isoform (2) missing an internal protein segment compared to isoform 1.
Write Your Own Review
You're reviewing:STEAP4 (NM_001205316) Human Untagged Clone
Your Rating
SKU Description Size Price
RC232371 STEAP4 (Myc-DDK tagged) - Homo sapiens STEAP family member 4 (STEAP4), transcript variant 3 10 ug
$330.00
RG232371 STEAP4 (tGFP-tagged) - Homo sapiens STEAP family member 4 (STEAP4), transcript variant 3 10 ug
$530.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.