CHURC 1 (CHURC1) (NM_001204063) Human Untagged Clone

SKU SC329689

CHURC1 (untagged) - Homo sapiens churchill domain containing 1 (CHURC1), transcript variant 2

Product Data

• Type: Human Untagged Clone
• Target Symbol: CHURC 1
• Synonyms: C14orf52; chch; My015
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC329689 representing NM_001204063.; Blue=Insert sequence Red=Cloning site Green=Tag(s); ; ATGCGGCAACCGTATCTCAGTTCTCGCGAGGTTTCGTCTTCCCGGAAGCGTTGGAGGACATTCCCTGTT; GACTGCGTCGCGATGTGTGGCGACTGTGTGGAGAAGGAATATCCCAACCGGGGTAATACCTGCCTGGAG; AATGGATCTTTCTTACTGAACTTTACAGGCTGTGCAGTGTGCAGTAAGCGGGATTTTATGCTGATCACA; AACAAATCCTTGAAAGAAGAAGATGGAGAAGAAATAGTTACCTATGATCATTTGTGTAAGAATTGTCAT; CATGTAATAGCCAGACATGAGTATACATTCAGTATCATGGATGAATTTCAGGAGTATACCATGCTGTGT; CTGTTATGCGGCAAAGCCGAAGATACTATCAGTATTCTCCCTGATGACCCCCGACAAATGACTCTCTTA; TTCTAA;
• Restriction Sites: SgfI-MluI
• ACCN: NM_001204063
• Insert Size: 420 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_001204063.1
• RefSeq Size: 3632 bp
• RefSeq ORF: 420 bp
• Locus ID: 91612
• UniProt ID: Q8WUH1
• Cytogenetics: 14q23.3
• Protein Families: Transcription Factors
• MW: 16.1 kDa
• Summary: Transcriptional activator that mediates FGF signaling during neural development. Plays a role in the regulation of cell movement (By similarity). Does not bind DNA by itself.[UniProtKB/Swiss-Prot Function]; Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 3' coding region, compared to variant 1. This results in a shorter protein (isoform 2), compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.