HHAT (NM_001170564) Human Untagged Clone

SKU
SC328570
HHAT (untagged)-Human hedgehog acyltransferase (HHAT) transcript variant 3
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol HHAT
Synonyms MART2; SKI1; Skn
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC328570 representing NM_001170564.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCTGCCCCGATGGGAACTGGCACTTTACCTACTTGCCTCACTAGGCTTCCACTTCTATTCCTTCTAT
GAAGTTTACAAAGTCTCCAGAGAACACGAAGAGGAGCTGGACCAGGAATTTGAGCTGGAGACTGACACT
TTATTTGGAGGATTAAAGAAGGATGCGACCGACTTTGAGTGGAGCTTCTGGATGGAATGGGGGAAGCAG
TGGCTGGTGTGGCTTCTCCTTGGCCACATGGTAGTGTCTCAAATGGCCACACTGCTGGCAAGAAAGATG
CAGCAGCAGGAGCATGACTCCCTGAAGGCCAGCCTGTGTGTCCTGGCCCTGGGGCTGGGCCGCCTTCTT
TGCTGGTGGTGGCTGGCCGAGCTGATGGCTCACCTGATGTACATGCATGCCATCTACAGCAGCATCCCC
CTCCTGGAGACTGTCTCTTGTTGGACCTTAGGAGGACTGGCGTTAGCCCAGGTGCTCTTTTTCTACGTG
AAGTACTTGGTGCTCTTTGGCGTGCCTGCTCTGCTCATGCGCCTGGATGGACTCACTCCACCCGCCCTC
CCCCGCTGCGTGAGCACCATGTTCAGTTTCACCGGGATGTGGAGGTATTTTGATGTTGGACTGCATAAT
TTCTTAATCAGGTATGTGTACATTCCAGTGGGCGGGTCCCAGCATGGCCTGCTGGGGACACTGTTTTCC
ACGGCGATGACATTTGCATTTGTGAGCTACTGGCATGGCGGCTACGACTACCTCTGGTGCTGGGCAGCG
CTCAACTGGCTGGGAGTCACTGTGGAGAATGGAGTCCGGAGGCTGGTGGAGACTCCCTGCATCCAGGAC
AGTCTGGCCCGATACTTCTCCCCACAAGCTCGCCGTCGATTCCACGCTGCCCTTGCTTCTTGTTCCACC
TCGATGCTGATCCTGTCCAACCTGGTATTTCTTGGGGGCAATGAGGTTGGGAAAACCTACTGGAATAGG
ATCTTCATACAAGGCTGGCCTTGGGTGACCCTCTCTGTCCTGGGATTCCTGTACTGCTACTCCCACGTG
GGCATTGCCTGGGCCCAGACCTACGCCACGGACTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001170564
Insert Size 1071 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001170564.2
RefSeq Size 3164 bp
RefSeq ORF 1071 bp
Locus ID 55733
UniProt ID Q5VTY9
Cytogenetics 1q32.2
Protein Families Transmembrane
MW 41.1 kDa
Summary 'Skinny hedgehog' (SKI1) encodes an enzyme that acts within the secretory pathway to catalyze amino-terminal palmitoylation of 'hedgehog' (see MIM 600725).[supplied by OMIM, Jul 2002]
Transcript Variant: This variant (3) differs in the 5' UTR and lacks two in-frame exons in the coding region, compared to variant 1. The encoded isoform (2) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:HHAT (NM_001170564) Human Untagged Clone
Your Rating
SKU Description Size Price
RC229932 HHAT (Myc-DDK-tagged)-Human hedgehog acyltransferase (HHAT), transcript variant 3 10 ug
$289.00 MSRP $457.00 MSRP $457.00
RC229932L3 Lenti-ORF clone of HHAT (Myc-DDK-tagged)-Human hedgehog acyltransferase (HHAT), transcript variant 3 10 ug
$757.00
RC229932L4 Lenti-ORF clone of HHAT (mGFP-tagged)-Human hedgehog acyltransferase (HHAT), transcript variant 3 10 ug
$757.00
RG229932 HHAT (tGFP-tagged) - Human hedgehog acyltransferase (HHAT), transcript variant 3 10 ug
$657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.