Claudin 7 (CLDN7) (NM_001185023) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | Claudin 7 |
Synonyms | CEPTRL2; claudin-1; CLDN-7; CPETRL2; Hs.84359 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>SC328220 representing NM_001185023.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCCAATTCGGGCCTGCAGTTGCTGGGCTTCTCCATGGCCCTGCTGGGCTGGGTGGGTCTGGTGGCC TGCACCGCCATCCCGCAGTGGCAGATGAGCTCCTATGCGGGTGACAACATCATCACGGCCCAGGCCATG TACAAGGGGCTGTGGATGGACTGCGTCACGCAGAGCACGGGGATGATGAGCTGCAAAATGTACGACTCG GTGCTCGCCCTGTCCGCGGCCTTGCAGGCCACTCGAGCCCTAATGGTGGTCTCCCTGGTGCTGGGCTTC CTGGCCATGTTTGTGGCCACGATGGGCATGAAGTGCACGCGCTGTGGGGGAGACGACAAAGTGAAGAAG GCCCGTATAGCCATGGGTGGAGGCATAATTTTCATCGTGGCAGGTATGAGTTTGGCCCTGCCATCTTTA TTGGCTGGGCAGGGTCTGCCCTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001185023 |
Insert Size | 438 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_001185023.1 |
RefSeq Size | 1944 bp |
RefSeq ORF | 438 bp |
Locus ID | 1366 |
UniProt ID | O95471 |
Cytogenetics | 17p13.1 |
Protein Families | Transmembrane |
Protein Pathways | Cell adhesion molecules (CAMs), Leukocyte transendothelial migration, Tight junction |
MW | 15.2 kDa |
Summary | This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. Differential expression of this gene has been observed in different types of malignancies, including breast cancer, ovarian cancer, hepatocellular carcinomas, urinary tumors, prostate cancer, lung cancer, head and neck cancers, thyroid carcinomas, etc.. Alternatively spliced transcript variants encoding different isoforms have been found.[provided by RefSeq, May 2010] Transcript Variant: This variant (3) lacks an exon in the 3' CDS, as compared to variant 1. The resulting isoform (2) has a shorter and distinct C-terminus, as compared to isoform 1. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC229582 | CLDN7 (Myc-DDK-tagged)-Human claudin 7 (CLDN7), transcript variant 3 | 10 ug |
$150.00
|
|
RC229582L3 | Lenti ORF clone of Human claudin 7 (CLDN7), transcript variant 3, Myc-DDK-tagged | 10 ug |
$450.00
|
|
RC229582L4 | Lenti ORF clone of Human claudin 7 (CLDN7), transcript variant 3, mGFP tagged | 10 ug |
$450.00
|
|
RG229582 | CLDN7 (tGFP-tagged) - Human claudin 7 (CLDN7), transcript variant 3 | 10 ug |
$350.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.