DUSP11 (NM_003584) Human Untagged Clone

SKU
SC327814
DUSP11 (untagged)-Human dual specificity phosphatase 11 (RNA/RNP complex 1-interacting) (DUSP11)
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol DUSP11
Synonyms PIR1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC327814 representing NM_003584.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCGCAATAGCGAGACGCTGGAGCGCGGCGTAGGTGGCTGCCGAGTCTTTTCCTGTTTAGGGTCTTAT
CCTGGCATTGAGGGCGCCGGACTGGCGCTTTTGGCCGACTTGGCATTGGGTGGGCGGCTTCTTGGGACC
CACATGAGCCAGTGGCATCATCCCCGCAGTGGCTGGGGCCGGAGACGCGACTTTTCAGGACGCTCCTCA
GCCAAGAAGAAGGGCGGAAACCACATCCCCGAAAGGTGGAAAGACTATCTCCCAGTTGGACAGCGGATG
CCTGGGACTCGTTTCATTGCTTTCAAAGTTCCTTTGCAAAAGAGTTTTGAAAAGAAACTTGCTCCAGAA
GAATGCTTTTCCCCTTTGGATCTTTTTAACAAAATCCGAGAACAAAATGAAGAACTTGGACTGATTATT
GATTTAACATATACTCAACGCTATTATAAACCAGAGGATTTGCCAGAAACTGTTCCTTACTTAAAAATT
TTTACAGTTGGACATCAAGTGCCTGATGATGAGACTATTTTTAAATTCAAACACGCTGTTAATGGGTTT
TTGAAAGAAAATAAAGATAATGATAAACTTATTGGTGTCCACTGTACCCATGGTTTAAACAGGACTGGC
TACCTCATTTGCAGATATTTGATTGATGTAGAAGGCGTGAGGCCAGATGATGCAATTGAATTATTCAAT
AGGTGCCGGGGACATTGCTTAGAAAGACAAAACTACATTGAAGACCTTCAGAATGGTCCTATCAGAAAG
AATTGGAATTCCAGTGTACCCAGGTCAAGTGATTTTGAAGACTCAGCACATCTCATGCAACCAGTCCAC
AATAAGCCTGTTAAACAAGGACCTAGGTATAATCTACATCAGATCCAGGGTCACTCAGCTCCTCGACAT
TTCCACACCCAGACCCAAAGTTTGCAACAATCAGTCAGAAAATTTTCAGAGAATCCACATGTTTACCAG
AGACACCATCTCCCTCCTCCTGGTCCCCCTGGAGAGGACTATTCACACAGGAGGTATTCTTGGAATGTG
AAGCCCAATGCCAGTCGGGCAGCCCAGGATAGAAGAAGGTGGTATCCTTATAATTACTCCAGACTCTCC
TATCCAGCCTGTTGGGAATGGACCCAGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_003584
Insert Size 1134 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_003584.2
RefSeq Size 1639 bp
RefSeq ORF 1134 bp
Locus ID 8446
UniProt ID O75319
Cytogenetics 2p13.1
Domains DSPc
Protein Families Druggable Genome, Phosphatase
MW 43.7 kDa
Summary The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which is associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product is localized to the nucleus and binds directly to RNA and splicing factors, and thus it is suggested to participate in nuclear mRNA metabolism. [provided by RefSeq, Sep 2008]
Write Your Own Review
You're reviewing:DUSP11 (NM_003584) Human Untagged Clone
Your Rating
SKU Description Size Price
RC201822 DUSP11 (Myc-DDK-tagged)-Human dual specificity phosphatase 11 (RNA/RNP complex 1-interacting) (DUSP11) 10 ug
$300.00
RC201822L1 Lenti ORF clone of Human dual specificity phosphatase 11 (RNA/RNP complex 1-interacting) (DUSP11), Myc-DDK-tagged 10 ug
$600.00
RC201822L2 Lenti ORF clone of Human dual specificity phosphatase 11 (RNA/RNP complex 1-interacting) (DUSP11), mGFP tagged 10 ug
$600.00
RC201822L3 Lenti ORF clone of Human dual specificity phosphatase 11 (RNA/RNP complex 1-interacting) (DUSP11), Myc-DDK-tagged 10 ug
$600.00
RC201822L4 Lenti ORF clone of Human dual specificity phosphatase 11 (RNA/RNP complex 1-interacting) (DUSP11), mGFP tagged 10 ug
$600.00
RG201822 DUSP11 (tGFP-tagged) - Human dual specificity phosphatase 11 (RNA/RNP complex 1-interacting) (DUSP11) 10 ug
$489.00 MSRP $500.00 MSRP $500.00
SC321328 DUSP11 (untagged)-Human dual specificity phosphatase 11 (RNA/RNP complex 1-interacting) (DUSP11) 10 ug
$300.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.